ID: 1181478611

View in Genome Browser
Species Human (GRCh38)
Location 22:23183334-23183356
Sequence ATGGAGGAGTTGAATGTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181478608_1181478611 28 Left 1181478608 22:23183283-23183305 CCTGTTAAGCTCATCTGGTTTTC 0: 1
1: 0
2: 0
3: 11
4: 141
Right 1181478611 22:23183334-23183356 ATGGAGGAGTTGAATGTGCTTGG 0: 1
1: 0
2: 2
3: 10
4: 210
1181478607_1181478611 29 Left 1181478607 22:23183282-23183304 CCCTGTTAAGCTCATCTGGTTTT 0: 1
1: 0
2: 0
3: 22
4: 171
Right 1181478611 22:23183334-23183356 ATGGAGGAGTTGAATGTGCTTGG 0: 1
1: 0
2: 2
3: 10
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181478611 Original CRISPR ATGGAGGAGTTGAATGTGCT TGG Intronic
900882332 1:5391062-5391084 ATGGAGGAGGGGTATGTGATGGG + Intergenic
904599269 1:31664842-31664864 ATGGAGGAGTAGAATGTGATAGG - Intronic
904980278 1:34495160-34495182 ATGGAGGAGGTGTGTGTGCGGGG - Intergenic
906522181 1:46474166-46474188 ATGGAGGAGGTGAAGGTGATGGG + Intergenic
907763078 1:57380877-57380899 ATTGAGGTGCTGCATGTGCTAGG - Intronic
912506144 1:110157743-110157765 ATGGAAGAGTGGGAGGTGCTGGG - Intronic
912949430 1:114110562-114110584 AGGGAGGACTTGCAAGTGCTTGG + Intronic
915486731 1:156226606-156226628 ATGAAGCATTTCAATGTGCTGGG + Intronic
916567791 1:165996641-165996663 ATGGAGGACCTCAATGTGCCAGG - Intergenic
916689758 1:167179086-167179108 AAGGAGGAGGTGACTGTTCTGGG + Intergenic
917237901 1:172914445-172914467 CTGGAGGAGATGAATTTGTTTGG + Intergenic
917492288 1:175507663-175507685 ATGTAGGAGTTCATTATGCTGGG - Intronic
918449408 1:184644523-184644545 AAGGAGGCTTTGAATGTGGTTGG - Intergenic
920869629 1:209783405-209783427 CTGGAGGAGCTGAAGGGGCTTGG - Exonic
921068038 1:211636766-211636788 ATGGAGGAGTAGAGTCGGCTGGG + Intergenic
921129715 1:212209300-212209322 ATGGAGGAGGTGGAGGTGCCAGG - Intergenic
921259335 1:213371812-213371834 GTGGAGGAGGTCAGTGTGCTCGG - Intergenic
923659927 1:235949239-235949261 ATGAAGGAGTTTATTTTGCTTGG - Intergenic
923731799 1:236558306-236558328 AAGGAGGAGAAGAATGTCCTGGG - Exonic
924690410 1:246344269-246344291 ATGGAGGACTTGAATGTAAGGGG - Intronic
1062819228 10:521850-521872 ATGGAGGCTGTGCATGTGCTGGG - Intronic
1062987805 10:1785625-1785647 ATGGAGCAGGTGAGTCTGCTCGG + Intergenic
1063740014 10:8807258-8807280 TTGGAGAAGTTGATGGTGCTTGG - Intergenic
1064005480 10:11695817-11695839 ATCAAGGTGTTGACTGTGCTGGG - Intergenic
1064086751 10:12350907-12350929 ATGGAGGTGTTGATTAGGCTGGG + Intronic
1067158711 10:43804168-43804190 ATGGAGAAGTTGAAATTCCTAGG - Intergenic
1067949302 10:50714233-50714255 ATGGAGGAGTTGGCTGGGCGCGG + Intergenic
1069174652 10:65275640-65275662 AAGTAGAAGTTGAATTTGCTTGG - Intergenic
1070320535 10:75351671-75351693 ATGGAGGAGTTGACTCTCCTGGG - Intergenic
1070884616 10:79879243-79879265 ATGGAGGAGTTGGCTGGGCGCGG + Intergenic
1071379341 10:85042462-85042484 TTGGAAAAGTTGTATGTGCTGGG + Intergenic
1073761451 10:106632902-106632924 ATGGAGGAGATGAATGAGTGAGG + Intronic
1075261734 10:120969297-120969319 ATGGAGGAGTTGAGTGGGAGCGG + Intergenic
1076266466 10:129113096-129113118 ATGGATGGGTTGAATGGGCCTGG - Intergenic
1076624288 10:131812024-131812046 GTGGCGGTGTTGAATCTGCTGGG - Intergenic
1076694633 10:132241204-132241226 CTGGAGGAGTTGGGTGGGCTGGG - Intronic
1078563609 11:12394748-12394770 CTGCAGGACTTGAGTGTGCTCGG - Intronic
1084876733 11:72138906-72138928 ATGGAGGAGATGGCTGTGGTGGG + Intronic
1089217434 11:116843066-116843088 AGGGAGCATTTGAATTTGCTGGG - Intergenic
1090946399 11:131433175-131433197 ATGGAAGAATTAAATGTGATGGG - Intronic
1091159402 11:133406088-133406110 ATTGAGGACTGTAATGTGCTAGG - Intronic
1092322057 12:7486767-7486789 ATGGAGGAGGTCGCTGTGCTGGG - Exonic
1092672933 12:10883629-10883651 ATGTAGTATTTCAATGTGCTGGG - Intronic
1092676796 12:10929839-10929861 ATGTAGTATTTTAATGTGCTGGG + Intronic
1092708555 12:11309815-11309837 ATGCAGTATTTCAATGTGCTGGG - Intronic
1095955273 12:47802431-47802453 CTGGAGGAGTCGAATGGGGTGGG - Intronic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099583309 12:84481790-84481812 AACGAGGAGTAGAATGAGCTTGG + Intergenic
1100607031 12:96160090-96160112 AGGCAGGGTTTGAATGTGCTTGG + Intergenic
1101325574 12:103712571-103712593 ATGGGGCAGTTGATTGTGCCTGG + Intronic
1102368982 12:112365515-112365537 ATTGAGCAGTTGAATGTGGCTGG - Intronic
1104875930 12:132034790-132034812 ATGAAGGACTTGAATGTTTTCGG + Intronic
1105651486 13:22383164-22383186 ATGGAGGAGTGGTATTTTCTAGG + Intergenic
1106670797 13:31903085-31903107 TGGGAGGAGTATAATGTGCTTGG - Intergenic
1106796284 13:33209106-33209128 ATTGGGGAGTGGAATGTGCATGG + Intronic
1106804078 13:33288151-33288173 ATGAATGTGTTGAAAGTGCTGGG + Intronic
1111350828 13:87028749-87028771 ATGGAATAGTAGAATGTGCATGG + Intergenic
1111560637 13:89940453-89940475 AGGGAGTATTTGCATGTGCTAGG - Intergenic
1112612850 13:100973029-100973051 TTGGAGTAGATGAATTTGCTGGG + Intergenic
1112802334 13:103126274-103126296 ATGGAGGATCTGAATTTCCTGGG + Intergenic
1113209625 13:107960472-107960494 AAGGAGGAGTGGAATGTGTGGGG + Intergenic
1114421407 14:22586634-22586656 ATGGAGGAGTCCAGTGAGCTGGG - Intronic
1114799002 14:25750389-25750411 AATGGGGAGATGAATGTGCTTGG + Intergenic
1115381925 14:32749782-32749804 ATGGAGGATTTGAATCTGGAAGG + Intronic
1120519102 14:85505532-85505554 ATGGAAGAGTTTAATTTGTTTGG - Intergenic
1122542411 14:102505740-102505762 ATGGAGGAGTCCAGGGTGCTGGG - Exonic
1128408252 15:67366217-67366239 ATGGATGGGTTGAACCTGCTGGG - Intronic
1128818844 15:70634283-70634305 ATGGAGGCATTAAATGTGCCTGG + Intergenic
1129491719 15:75932969-75932991 ATGGAGAAATTGGATGTGATCGG + Exonic
1129791767 15:78345644-78345666 AGGGAGGATTTGAAAGTGATGGG - Intronic
1130085162 15:80771897-80771919 CAGGAGGAGGTGAATGTTCTAGG + Intergenic
1130876554 15:88019476-88019498 CTGGAGGAGCTTAAAGTGCTTGG + Intronic
1131456498 15:92586166-92586188 AAGGATGTGTTGAGTGTGCTGGG + Intergenic
1131915068 15:97256159-97256181 ATTGAGGAATTAAATGTGCTTGG - Intergenic
1133751278 16:8727669-8727691 ATGGAAGAATTTAATGTACTAGG - Intronic
1133975091 16:10594891-10594913 ATGGAGGAGGGGCATGTGCACGG - Intergenic
1134650479 16:15904605-15904627 ATGGAGGAGTGGAGTGGACTGGG - Intergenic
1134650780 16:15907010-15907032 ATGGAGGAGTGGAGTGGACTGGG - Intergenic
1135623697 16:23977332-23977354 CTGGGTGATTTGAATGTGCTTGG - Intronic
1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG + Intronic
1137006223 16:35276343-35276365 ATTCAGGAGTTGAATTTGGTGGG + Intergenic
1138244580 16:55457934-55457956 AAGGAGGAGTCAATTGTGCTGGG + Intronic
1138276211 16:55736779-55736801 TGGGAGGAGTTGAGTGTCCTTGG - Intergenic
1138471463 16:57241366-57241388 ATGGAGGAGTGGGGTGGGCTGGG + Intergenic
1138796450 16:59975361-59975383 GTGGAGGATTAGAATGTGGTAGG + Intergenic
1139018354 16:62717673-62717695 ATGAAGCAGTTTTATGTGCTAGG + Intergenic
1141481406 16:84309146-84309168 TTTGAAGAGATGAATGTGCTTGG + Intronic
1143376953 17:6472587-6472609 TTGGAGGGGTTGAATGGGCTGGG + Intronic
1144733368 17:17541324-17541346 CTGGAGGAGCTGAAAGAGCTGGG - Intronic
1145764286 17:27447765-27447787 TTGGAAGAGTTGTCTGTGCTTGG - Intergenic
1145776500 17:27532657-27532679 GTGGAGGAGAGGACTGTGCTAGG + Intronic
1146677880 17:34785951-34785973 TTGCAGGAGGTGAATGTGGTGGG - Intergenic
1149000472 17:51752364-51752386 ATGGAGAAGTTGAAGCTGCAGGG + Intronic
1150306034 17:64086081-64086103 AAGGAGGAGTTGAAGATCCTTGG - Intronic
1152168988 17:78730979-78731001 AAGGAAGAAGTGAATGTGCTAGG + Intronic
1152287717 17:79422336-79422358 AGGGAGGGGTTGAATGTGTGGGG - Intronic
1155583153 18:27335100-27335122 ATGAAGGAGTTGAAGGTAATAGG + Intergenic
1156888714 18:42165398-42165420 AGGGAGGAATTGAAAGTTCTTGG - Intergenic
1157418791 18:47527533-47527555 ATGGAGGAGGAGACTGAGCTGGG + Intergenic
1157424832 18:47576073-47576095 ATGGACCAGTAGAATTTGCTTGG - Intergenic
1159734698 18:72080609-72080631 ATTGAGGATTTGAATCTCCTTGG - Intergenic
1161897018 19:7090038-7090060 GTAGAGGAGGTGAATCTGCTGGG + Intergenic
1162761678 19:12892142-12892164 ATGGGGGAGTTGGGTGTGCTGGG + Exonic
1163493107 19:17628409-17628431 ATGGCGGTGTTGAATGTGCGTGG - Intronic
1166403516 19:42502204-42502226 ATGGAGGAGGTCACAGTGCTAGG + Intergenic
1166712416 19:44945792-44945814 GTGGAGGGGTTGGAGGTGCTGGG - Intronic
925619415 2:5776478-5776500 ATGGAGGAGTCAGATGAGCTTGG + Intergenic
927762235 2:25768801-25768823 TTGGAGGAGATGGATATGCTTGG + Exonic
928642189 2:33311394-33311416 ATGCAGAAATTAAATGTGCTTGG + Intronic
929015164 2:37486584-37486606 AGGGATGTGTTGAATGTGGTTGG - Intergenic
933258737 2:80108478-80108500 ATGGAGGAGTGGCATGTGCCAGG - Intronic
935014337 2:99165787-99165809 ATGGAGCAGTTGCATCTGATTGG - Intronic
943792163 2:191945379-191945401 AAGGAGGCTTTGAATGTGCTGGG + Intergenic
944253849 2:197604608-197604630 GTGGAGGAAGTGAATGTGATGGG + Intronic
946526672 2:220528127-220528149 AAGGAGGTGTTCAATGTTCTAGG + Intergenic
948340322 2:237245512-237245534 ATGGAGGGGATGCATGGGCTTGG - Intergenic
948375844 2:237519768-237519790 GTGGAGGGGGTGGATGTGCTGGG + Intronic
948646047 2:239405797-239405819 ATGGAAGAGTTGAAAGTCTTAGG - Intergenic
949058510 2:241943051-241943073 ATCGAGGCGTTGACTGGGCTGGG + Intergenic
1169073410 20:2747653-2747675 ATGTGGGAGGTGAATTTGCTGGG + Intronic
1172936604 20:38624969-38624991 ATGGAGGAGGGGAATGTGCTTGG - Intronic
1173544703 20:43886222-43886244 ATGGAGGTGTTTTATGTTCTGGG - Intergenic
1174960042 20:55145816-55145838 ATGGATGACTACAATGTGCTAGG + Intergenic
1179319565 21:40277078-40277100 CTGGAGGAGTTGGGTGGGCTGGG + Intronic
1181478611 22:23183334-23183356 ATGGAGGAGTTGAATGTGCTTGG + Intronic
1182849909 22:33464241-33464263 ATGAAGGAGTTAAATGTGAAAGG + Intronic
1183148681 22:36019289-36019311 GTGGAGGAGTGGAATGAACTGGG - Intronic
1183397003 22:37577266-37577288 ATGCAGGATGTGAATGTGCCAGG - Intronic
951422492 3:22503890-22503912 ACTGAAGAGTTAAATGTGCTTGG - Intergenic
951651217 3:24953810-24953832 AAGTAGGAGTTGAATGGGCACGG - Intergenic
952665581 3:35900252-35900274 TTGGGGGGGTGGAATGTGCTTGG + Intergenic
953862824 3:46559893-46559915 AAGGGGGCGTTGAATGTGCCAGG + Intronic
954236430 3:49260676-49260698 ATGGAGGAGTTGAATTTTCCCGG + Intergenic
956620414 3:71216444-71216466 ATGGTTGATTTGAATGGGCTGGG + Intronic
957441637 3:80255372-80255394 ATGGAGGATTTAAATGCTCTAGG - Intergenic
957518708 3:81290844-81290866 CTGCAGGACTTGAATGTGCCTGG - Intergenic
961092543 3:124126861-124126883 ATTGAGGGGTGGAATGTGCCAGG - Intronic
961386939 3:126528096-126528118 ATGGAGGAGTGAAATGGCCTGGG + Intronic
961576512 3:127841216-127841238 ATAGATGGGTTGAATTTGCTTGG + Intergenic
963548778 3:146695260-146695282 ATAGAAGAGTTGAATGAGGTTGG + Intergenic
964486052 3:157186260-157186282 AGGGATGAGTTGAATGGGCAAGG + Intergenic
964691387 3:159453947-159453969 ATGGTGGAGTAGAAGGAGCTTGG - Intronic
969520830 4:7676968-7676990 AAGGAGGAGATGAAGGGGCTGGG - Intronic
970110784 4:12635843-12635865 ATGGTAGAGTTCAGTGTGCTTGG + Intergenic
970195861 4:13549261-13549283 ATGGAGGTGTTGATCGTGCCTGG - Intergenic
973237959 4:47926458-47926480 CTGGAGGAGTTGAGTATGCTTGG + Intronic
973260406 4:48157906-48157928 ATGGAGGGATTGATTATGCTGGG - Intronic
974514182 4:62886875-62886897 ATTGAGGAGTTGCATGTTGTGGG - Intergenic
975091371 4:70408212-70408234 AGGAAGGAGTTGAATGTTGTAGG + Intronic
975108728 4:70599592-70599614 ATGGAAGAGAGGAATGTGGTGGG - Exonic
975543620 4:75538971-75538993 GTGGAAATGTTGAATGTGCTAGG - Intronic
982066629 4:151660135-151660157 ATGGAGAATTTGATGGTGCTTGG + Intronic
982068316 4:151673546-151673568 CTGTAGGAGATGAATGTGGTAGG - Intronic
982189242 4:152836664-152836686 ATGAATGAGTTTAATGTGCAAGG - Intronic
986376509 5:7137443-7137465 AAGGATGAGTTGCATGTCCTTGG + Intergenic
990732633 5:58826120-58826142 ATGTAGGAGTGGAGTGTGATGGG + Intronic
993231797 5:85246689-85246711 ATGGAGGATATGCATGGGCTAGG - Intergenic
993852223 5:93024361-93024383 GAGGTGGAATTGAATGTGCTGGG + Intergenic
994210104 5:97078240-97078262 ATGGAGGACTAGAAGATGCTTGG + Intergenic
997970978 5:138401638-138401660 ATGTAGGAGTGGAATTGGCTAGG + Intronic
999121061 5:149209716-149209738 AGGGAGGAGTTGAAAGGGTTGGG + Intronic
999142109 5:149369231-149369253 TTGGAGGAGATGACTGTGGTAGG + Exonic
999229628 5:150054014-150054036 ATGGAGGAGTTGAAGTTTGTGGG + Exonic
999378100 5:151101044-151101066 AGGGGCCAGTTGAATGTGCTGGG - Intronic
999495659 5:152094277-152094299 ATGGATGAGTTGCAGCTGCTCGG - Intergenic
999893532 5:156004597-156004619 GTGGAAGAGTTGAAAGTACTTGG - Intronic
1000341445 5:160280106-160280128 ATGGGGGATATGAACGTGCTGGG - Intronic
1001137979 5:169118315-169118337 ATGGAGGACATGTGTGTGCTGGG + Intronic
1001657874 5:173366957-173366979 ATGGATTAATTGAATGTCCTGGG + Intergenic
1002279084 5:178120460-178120482 AGGGAGGAGCTGAAGGGGCTAGG - Exonic
1002958406 6:1891351-1891373 GAAGAGGAGTTTAATGTGCTGGG + Intronic
1003822762 6:9918284-9918306 ATGGAGGAGCAGCATGTGGTGGG - Intronic
1007911179 6:45515671-45515693 TTTGAGGAGTTCTATGTGCTAGG - Intronic
1008096797 6:47347181-47347203 CTGGAGGAGGTGATGGTGCTGGG + Intergenic
1012218072 6:96613311-96613333 ATGAAGCAGTTCAATGTGATGGG - Intronic
1013656414 6:112251404-112251426 ATGGAGCAGTGGGAGGTGCTTGG - Intronic
1015862381 6:137694499-137694521 ATTGAGCAGTTAAATGTGCCAGG - Intergenic
1022616701 7:31938790-31938812 ATTGAGTAGTTTTATGTGCTAGG - Intronic
1023249164 7:38239006-38239028 GTGGAGGACTTGCATGTGCCAGG + Intergenic
1023250813 7:38259070-38259092 GTGGAGGACTTGCATGTGCCAGG + Intergenic
1023560190 7:41465986-41466008 GTGGAGGAGTTGTAACTGCTTGG + Intergenic
1023756546 7:43423613-43423635 ATGGAGGAATAGAGTGAGCTGGG + Intronic
1023895272 7:44427767-44427789 ATGTAGGAGTGGCATGGGCTAGG - Intronic
1024995475 7:55270698-55270720 ATGGAGGTGTGGAGTGTGTTGGG - Intergenic
1025016027 7:55439780-55439802 ATGGAGGAGGCGGAGGTGCTGGG + Intronic
1027530356 7:79323419-79323441 ATGGAGCAGTTTAATGTGAGAGG + Intronic
1028669249 7:93382290-93382312 AGGCAGGACTTGAATGTACTGGG + Intergenic
1029191064 7:98772660-98772682 ATGGTGGAGTGGAGTGGGCTTGG - Intergenic
1031863558 7:127012170-127012192 TTTGAGGAGTTGCAGGTGCTTGG - Intronic
1031999907 7:128258102-128258124 ATGGAGGGGTACATTGTGCTGGG - Intergenic
1033244040 7:139703908-139703930 GTGGAGGGGTTGTATGTGTTGGG - Intronic
1035311950 7:157975095-157975117 CAGGAGGAGGAGAATGTGCTGGG - Intronic
1036480639 8:9136125-9136147 ATGGCTGAGTTAAATGTGCAAGG - Intergenic
1037705986 8:21315685-21315707 TTGGAGGAGTAGAATGTTCGAGG - Intergenic
1038613780 8:29075267-29075289 ATGGAGGAGGTGAGTCTGTTGGG - Exonic
1039333780 8:36567729-36567751 ATGGAGGGGTTGCTTGTGTTGGG - Intergenic
1040092396 8:43411123-43411145 ATGAAGGACTTCCATGTGCTGGG - Intergenic
1040770445 8:50969324-50969346 AAGGAGGAGGTGCATGTGCATGG - Intergenic
1041321748 8:56621132-56621154 AGGGAGGAGGTGACTCTGCTTGG - Intergenic
1041843250 8:62296398-62296420 GTGTGGGAGTTGAATGTGATAGG + Intronic
1042601858 8:70506633-70506655 ATGGAGGAGTTAAGGGTGGTTGG - Intergenic
1044660337 8:94589035-94589057 CTACAGGAGTTGAATGTCCTAGG + Intergenic
1046759267 8:118004364-118004386 ATTGAGGAGCTAAATGTGCCAGG - Intronic
1047973308 8:130105735-130105757 ATGGTGGAGTAGAGTGCGCTGGG + Intronic
1048524031 8:135184821-135184843 AGGGAGGAATAGAATGTGCAAGG - Intergenic
1049687913 8:143946355-143946377 ATGGAGGAGCTGATTCAGCTGGG - Intronic
1051127931 9:13825276-13825298 CAGGAGGTGTTGAAGGTGCTGGG + Intergenic
1055505356 9:76942541-76942563 ATGAAGGAGCTGAAGTTGCTTGG - Intergenic
1057824841 9:98364450-98364472 ATGGAGGAGGAGAAGCTGCTTGG - Intronic
1058531051 9:105904972-105904994 CTGGAGGCCTTGAATTTGCTGGG + Intergenic
1059014076 9:110495135-110495157 ATGGAGAAGTTGAATATACAAGG - Intronic
1059584959 9:115596120-115596142 ATGGAGAAGTTCAAGGCGCTTGG - Intergenic
1062124783 9:134854265-134854287 ATGGAGCAGGTGGCTGTGCTGGG - Intergenic
1062137087 9:134934905-134934927 AAGGAGGAGGTGACAGTGCTGGG - Intergenic
1185965632 X:4598731-4598753 ATGGAGGAGGTGAAAGTATTGGG - Intergenic
1188057026 X:25553371-25553393 ATGGAGGATGTGAATGTCATCGG + Intergenic
1188653649 X:32663948-32663970 AAGGAGGAGGTGATTGTGCATGG + Intronic
1189206012 X:39239418-39239440 ATGGAGGAGTGGCATGGGATGGG + Intergenic
1190775533 X:53549571-53549593 ATGGGGGAGGGGAATGAGCTAGG + Intronic
1191681728 X:63847642-63847664 GTGGAGGAGTGGAATGAGCACGG + Intergenic
1194520309 X:94909889-94909911 ATAGAGGTGTTGATAGTGCTGGG - Intergenic
1195397746 X:104429570-104429592 ATGGAGGAGTAGGATGGACTTGG - Intergenic
1197316095 X:124967671-124967693 ATGGAGGAGTGGTAAGTTCTAGG - Intergenic