ID: 1181483715 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:23217835-23217857 |
Sequence | TGAAGGCGGGGATCCCGGGT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1181483706_1181483715 | -2 | Left | 1181483706 | 22:23217814-23217836 | CCTGGAGGGAGGGCACTCCCATG | No data | ||
Right | 1181483715 | 22:23217835-23217857 | TGAAGGCGGGGATCCCGGGTAGG | No data | ||||
1181483700_1181483715 | 22 | Left | 1181483700 | 22:23217790-23217812 | CCTACGTGTGGGATGCTCGTGAG | No data | ||
Right | 1181483715 | 22:23217835-23217857 | TGAAGGCGGGGATCCCGGGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1181483715 | Original CRISPR | TGAAGGCGGGGATCCCGGGT AGG | Intronic | ||