ID: 1181483715

View in Genome Browser
Species Human (GRCh38)
Location 22:23217835-23217857
Sequence TGAAGGCGGGGATCCCGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181483706_1181483715 -2 Left 1181483706 22:23217814-23217836 CCTGGAGGGAGGGCACTCCCATG No data
Right 1181483715 22:23217835-23217857 TGAAGGCGGGGATCCCGGGTAGG No data
1181483700_1181483715 22 Left 1181483700 22:23217790-23217812 CCTACGTGTGGGATGCTCGTGAG No data
Right 1181483715 22:23217835-23217857 TGAAGGCGGGGATCCCGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181483715 Original CRISPR TGAAGGCGGGGATCCCGGGT AGG Intronic