ID: 1181485589

View in Genome Browser
Species Human (GRCh38)
Location 22:23229787-23229809
Sequence AGAAGGCAGTTCCCCCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 164}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181485576_1181485589 25 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1181485576 22:23229739-23229761 CCCTATACTCTCTACTTCCCCAT 0: 1
1: 0
2: 1
3: 22
4: 293
Right 1181485589 22:23229787-23229809 AGAAGGCAGTTCCCCCCTGAGGG 0: 1
1: 0
2: 0
3: 9
4: 164
1181485583_1181485589 -1 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1181485583 22:23229765-23229787 CCCCCTTTCAGGTGTTCTGATTA 0: 1
1: 0
2: 3
3: 16
4: 237
Right 1181485589 22:23229787-23229809 AGAAGGCAGTTCCCCCCTGAGGG 0: 1
1: 0
2: 0
3: 9
4: 164
1181485585_1181485589 -3 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1181485585 22:23229767-23229789 CCCTTTCAGGTGTTCTGATTAGA 0: 1
1: 0
2: 0
3: 19
4: 204
Right 1181485589 22:23229787-23229809 AGAAGGCAGTTCCCCCCTGAGGG 0: 1
1: 0
2: 0
3: 9
4: 164
1181485581_1181485589 6 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1181485581 22:23229758-23229780 CCATGTCCCCCCTTTCAGGTGTT 0: 1
1: 0
2: 0
3: 25
4: 169
Right 1181485589 22:23229787-23229809 AGAAGGCAGTTCCCCCCTGAGGG 0: 1
1: 0
2: 0
3: 9
4: 164
1181485586_1181485589 -4 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1181485586 22:23229768-23229790 CCTTTCAGGTGTTCTGATTAGAA 0: 1
1: 0
2: 1
3: 15
4: 170
Right 1181485589 22:23229787-23229809 AGAAGGCAGTTCCCCCCTGAGGG 0: 1
1: 0
2: 0
3: 9
4: 164
1181485579_1181485589 8 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1181485579 22:23229756-23229778 CCCCATGTCCCCCCTTTCAGGTG 0: 1
1: 0
2: 0
3: 9
4: 255
Right 1181485589 22:23229787-23229809 AGAAGGCAGTTCCCCCCTGAGGG 0: 1
1: 0
2: 0
3: 9
4: 164
1181485582_1181485589 0 Complete closest: 909
total_pairs: 2
max_distance: 1000
Left 1181485582 22:23229764-23229786 CCCCCCTTTCAGGTGTTCTGATT 0: 1
1: 0
2: 0
3: 16
4: 233
Right 1181485589 22:23229787-23229809 AGAAGGCAGTTCCCCCCTGAGGG 0: 1
1: 0
2: 0
3: 9
4: 164
1181485577_1181485589 24 Complete closest: 395
total_pairs: 2
max_distance: 1000
Left 1181485577 22:23229740-23229762 CCTATACTCTCTACTTCCCCATG 0: 1
1: 0
2: 2
3: 17
4: 226
Right 1181485589 22:23229787-23229809 AGAAGGCAGTTCCCCCCTGAGGG 0: 1
1: 0
2: 0
3: 9
4: 164
1181485584_1181485589 -2 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1181485584 22:23229766-23229788 CCCCTTTCAGGTGTTCTGATTAG 0: 1
1: 0
2: 1
3: 13
4: 163
Right 1181485589 22:23229787-23229809 AGAAGGCAGTTCCCCCCTGAGGG 0: 1
1: 0
2: 0
3: 9
4: 164
1181485580_1181485589 7 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1181485580 22:23229757-23229779 CCCATGTCCCCCCTTTCAGGTGT 0: 1
1: 0
2: 0
3: 14
4: 119
Right 1181485589 22:23229787-23229809 AGAAGGCAGTTCCCCCCTGAGGG 0: 1
1: 0
2: 0
3: 9
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181485589 Original CRISPR AGAAGGCAGTTCCCCCCTGA GGG Intronic
901808843 1:11754460-11754482 AGAAGGCAGTGACCTCCTGTGGG - Intronic
902696964 1:18146579-18146601 AGGAGGCACTTCTCCCCTAAGGG - Intronic
903280346 1:22246572-22246594 AGAAGGCAGGTAGACCCTGAGGG + Intergenic
905314612 1:37074015-37074037 GGAAGGCATGTCCCCACTGATGG + Intergenic
909384247 1:75037009-75037031 AGTAGACAGTTTTCCCCTGATGG + Intergenic
909804692 1:79859297-79859319 AGAGGGCAGTTCCCTGGTGAAGG - Intergenic
911205771 1:95090344-95090366 AGAGGGCAGGTCCCCGGTGAGGG - Intergenic
911425136 1:97700151-97700173 AGAAGTCACTTTTCCCCTGAGGG + Intronic
912757051 1:112333278-112333300 GGAAGACACTTCCCCCCTGGAGG - Intergenic
913060797 1:115205736-115205758 AAATGGCAGTTCCCCCCAAATGG + Intergenic
916298822 1:163250616-163250638 AAAAGGCATTTCCTCTCTGAAGG - Intronic
918356350 1:183709134-183709156 AGAAGACACGTACCCCCTGAAGG - Intronic
920924918 1:210331787-210331809 TGAACACAGTTCTCCCCTGAAGG + Intronic
1063226849 10:4023584-4023606 AGATGGCAGCTCTCCCCTGTGGG - Intergenic
1067521823 10:47013642-47013664 AGGAGGCAGCTCCACCCGGAGGG + Intergenic
1068971344 10:62961496-62961518 AGTAGGCAGTTCCCCTCTCCCGG + Intergenic
1070662837 10:78319921-78319943 AGAAGGCAGTTACACCCCAAAGG + Intergenic
1071256547 10:83876897-83876919 TAAAGTCAGTTCCCCCGTGAGGG - Intergenic
1071365779 10:84899412-84899434 TAAAGGCAGTGCCACCCTGAAGG + Intergenic
1071981674 10:91009834-91009856 AGAAGGCTGTTCTAGCCTGAAGG - Intergenic
1072187211 10:93051441-93051463 TGAAGGCAGTTAACACCTGAAGG + Intronic
1073231454 10:101974578-101974600 AAGAGGCACTTCCCCCCTGCAGG + Intronic
1074366724 10:112863679-112863701 AGAGGGCAGTTCCCCTCCCACGG - Intergenic
1075615952 10:123891282-123891304 AGAAGCCAGTTGTCCCCTGGAGG + Intronic
1077003089 11:334859-334881 AGCAGGCAATCCTCCCCTGATGG - Intergenic
1079427441 11:20356933-20356955 AAAAGCCAGTTCCCTTCTGAAGG - Intergenic
1080059005 11:27937268-27937290 AGAAGGCATTTTCCCCATGGTGG + Intergenic
1080534116 11:33205118-33205140 GGAAGGCAGTTTTCCCTTGAAGG + Intergenic
1080574517 11:33585993-33586015 AGGAGGCAGTTCCACCCTGCTGG - Intronic
1083672316 11:64306169-64306191 AGGAGGAAGTTCTCCCCTGCCGG - Intronic
1089777978 11:120852309-120852331 TAAAGGCAGTTCTACCCTGATGG + Intronic
1090469464 11:126967402-126967424 AGAAGGCAGATCTTCCCTGTGGG - Intronic
1090722389 11:129488318-129488340 ATAAGGTAGTCCCTCCCTGAGGG - Intergenic
1091133630 11:133167956-133167978 AGAAGACAGTGTCCCCCTTAGGG + Intronic
1100207122 12:92363079-92363101 GGGAGGCAGTTCTCTCCTGAGGG - Intergenic
1101052110 12:100874246-100874268 ACAAGGCAGTGCCCCAGTGAAGG - Intronic
1103590266 12:121987209-121987231 AGCAGGCATTTCCATCCTGAAGG + Intronic
1104721839 12:131048792-131048814 AGGAGCCAGGTCCCTCCTGAAGG + Intronic
1106823232 13:33490285-33490307 AGAAGGCAGTTCCCCGGCAAAGG + Intergenic
1107649194 13:42527302-42527324 AGAAGGCAACTCCTGCCTGAGGG + Intergenic
1112602500 13:100870040-100870062 GGAAGGCAGATCCCAGCTGAAGG - Intergenic
1118510475 14:66466252-66466274 AGAAGGCAGTTACTCCTTTATGG + Intergenic
1118516081 14:66530243-66530265 AGTAGGCAGTTTTCCCCTCACGG - Intronic
1120925495 14:89793471-89793493 AGAGAGCAGTGCCCCTCTGAGGG - Intergenic
1202899838 14_GL000194v1_random:28602-28624 AGAACGCAGCTCCGCCCTCATGG - Intergenic
1124696180 15:31866516-31866538 TGAAGGCGGTTCCCCCCTTGTGG + Intronic
1126554095 15:49966464-49966486 AGTAGGCAGTTTTCCCCTCACGG + Intronic
1126592028 15:50350074-50350096 AGAAGGCAGTACCCCACTGTAGG + Intronic
1127453288 15:59136905-59136927 AGAGGGCGGGTCCTCCCTGAAGG + Exonic
1127779792 15:62302214-62302236 AGAAAACAGTTACCTCCTGATGG + Intergenic
1127895501 15:63295307-63295329 TGAAGGCAGGTCCCCCATTAGGG + Intronic
1128936792 15:71753528-71753550 AGAAGGCAGTCCCCACCAGAGGG + Intronic
1132097332 15:98997525-98997547 AAGAGGCAGTTCCCTCCTCAAGG + Intronic
1137043878 16:35638865-35638887 AGGAGGCTCTTCCCTCCTGAGGG + Intergenic
1137618591 16:49860928-49860950 AGATCGCAGTTCCTCCCTGTTGG + Intergenic
1139860063 16:70013220-70013242 TGAAAGTAGTTCTCCCCTGATGG - Intergenic
1139930515 16:70522572-70522594 AAAAGGCAGTTTCAGCCTGAGGG - Intronic
1141622005 16:85241324-85241346 ACCTGGCAGTTGCCCCCTGAGGG + Intergenic
1141622986 16:85247002-85247024 AGAAGGCGGTGCCCCCCTCTAGG - Intergenic
1141739143 16:85878980-85879002 AGGAGGCAGTGCCTGCCTGAAGG + Intergenic
1141739154 16:85879077-85879099 AGCAGCCAGCTCACCCCTGATGG + Intergenic
1203123094 16_KI270728v1_random:1555675-1555697 AGAACGCAGCTCCACCCTCACGG - Intergenic
1146359198 17:32160065-32160087 AGAGGGTAGTTCCTCCCTGTAGG - Intronic
1146673018 17:34755054-34755076 AGAAAGCTGCTCCTCCCTGATGG - Intergenic
1146892232 17:36513662-36513684 AGAAGGCAGCTCCCTCAGGAAGG + Exonic
1148106538 17:45121643-45121665 CGAGGGCAGTTCCACACTGAGGG - Intronic
1149507049 17:57203203-57203225 AGAAGGCAGCTCCCTCATGCTGG + Intergenic
1149545629 17:57501484-57501506 AGAAGGCAGTTTATCCCTCAAGG + Intronic
1150264439 17:63823189-63823211 AGAATGCTGCTCCCCTCTGAGGG + Intronic
1151434904 17:74089169-74089191 AGAAGGCTGCCCCACCCTGATGG - Intergenic
1156701186 18:39827196-39827218 AGATAGCAATTCCCCCTTGAAGG - Intergenic
1157274079 18:46297904-46297926 GGAAGACAGCTGCCCCCTGACGG + Intergenic
1158198016 18:54910099-54910121 AGAAGGGAGCTGCCCCCTGCAGG - Intronic
1161988336 19:7669866-7669888 AGTAGCCAGGTCCCCCCTGGAGG - Exonic
1164755949 19:30689679-30689701 GGAAGGCATTTGCCCCCAGATGG - Intronic
1165110110 19:33497449-33497471 AGAAGGCAGTTCCCCTGAGAAGG - Intronic
1165287286 19:34852688-34852710 AGAAGTCAGTTTCCCCCTGCAGG + Intergenic
1165481508 19:36067219-36067241 AGCAGGGAGTTCCAGCCTGAGGG + Intronic
1165757939 19:38304945-38304967 AGAAGGAGGCTCCCCACTGAAGG + Exonic
1166556481 19:43703434-43703456 TGAAGGGAGATCTCCCCTGAAGG - Intergenic
1166719018 19:44986971-44986993 GGCAGGCAGGTCCCCACTGAAGG - Intronic
1166742984 19:45125509-45125531 GGAAGGCTGTTCCCTCCTGATGG + Intronic
925295214 2:2771982-2772004 AGAAGCCAGTTACCTCCAGAAGG + Intergenic
926377969 2:12252991-12253013 ACAAAGCAGTTCCTCCCAGAAGG + Intergenic
926579210 2:14616281-14616303 AGAAGTCATGTCCCCCCTGTAGG - Intergenic
927213348 2:20651769-20651791 AGGAGCCAGTTCCCCTCAGAAGG + Intergenic
929821700 2:45279304-45279326 AGAAGGCAGTTCCCATTTTATGG - Intergenic
930191352 2:48463299-48463321 AGAAGGGAGTTTCAACCTGATGG + Intronic
931839626 2:66134960-66134982 AGAGGGCACTTCCCACCTAAAGG - Intergenic
932474060 2:71990260-71990282 AGATCGCAGTCCCCCCGTGAGGG + Intergenic
933732598 2:85468819-85468841 AGAAGTCAGCTCCACCCTGCAGG - Intergenic
933743506 2:85553288-85553310 TGAAGGCAGCTCCCAGCTGATGG + Exonic
935390628 2:102548786-102548808 ACAAGGCAGTTCCTCCCAGCTGG + Intergenic
935443568 2:103132253-103132275 AGATGCCATTTCCCACCTGACGG + Intergenic
935662447 2:105478836-105478858 AGAGGCCAGTTCCCCACAGAGGG - Intergenic
937256956 2:120562374-120562396 AGGAGACAGTTCCCGCCTGGAGG - Intergenic
938180608 2:129178959-129178981 GGAAGGGAGATGCCCCCTGAGGG - Intergenic
938780160 2:134577457-134577479 AGAAGCCAGTTCCTCGCTGAGGG + Intronic
944345287 2:198657694-198657716 CGAAGGCAGTTGCCACCAGAGGG + Intergenic
945377503 2:209096677-209096699 AGAAGGCAGTTCCCCGGCAAAGG + Intergenic
946396596 2:219446460-219446482 AGAAGACACTTCCTCCCTGCAGG + Intronic
946426795 2:219602876-219602898 AGAATGCAGCTCCACCCTCATGG - Intronic
947286968 2:228527948-228527970 AGAAGGCTGTTCCACACAGAGGG + Intergenic
1168891752 20:1299552-1299574 AGAAGGAATTTCCACCCAGAGGG - Intronic
1169237275 20:3941004-3941026 ATAAGGCTGTTCCTCCGTGAAGG + Intronic
1170868033 20:20177668-20177690 AGAATGCAGGCCCCCCGTGAGGG - Intronic
1171146413 20:22787594-22787616 AGAAGGCAAAACCACCCTGAGGG + Intergenic
1173089413 20:39955929-39955951 AGATGGCAGTCAGCCCCTGAGGG - Intergenic
1173749957 20:45469313-45469335 AGAGGGCAGATCCCTCTTGATGG - Intergenic
1174708659 20:52682767-52682789 AGTAGGCAGATCCTCCCTGCAGG + Intergenic
1176047288 20:63099517-63099539 AGAAGGAGGTCCCCCCCTGCCGG + Intergenic
1176344421 21:5728702-5728724 AGTAGACAGTTTTCCCCTGACGG - Intergenic
1176351235 21:5849286-5849308 AGTAGACAGTTTTCCCCTGACGG - Intergenic
1176500406 21:7595754-7595776 AGTAGACAGTTTTCCCCTGACGG + Intergenic
1176538742 21:8126771-8126793 AGTAGACAGTTTTCCCCTGACGG - Intergenic
1176619212 21:9043376-9043398 AGAACGCAGCTCCGCCCTCACGG - Intergenic
1177497771 21:21911057-21911079 AGAGGGCAGTTCCCCCGCAAAGG - Intergenic
1181485589 22:23229787-23229809 AGAAGGCAGTTCCCCCCTGAGGG + Intronic
1182058822 22:27382222-27382244 AGAAGGCAGACTCCCCCTGTAGG + Intergenic
1182891911 22:33826293-33826315 AGAAGGCAGTGTGACCCTGAGGG - Intronic
1185341720 22:50293972-50293994 AGAAGGCAGCTGCCACCTGTAGG - Intronic
950170750 3:10837685-10837707 AGCAGGCTGTTCCACCCTCAGGG - Intronic
952586758 3:34902449-34902471 AGAAACCAGTTCCCTCCTCATGG + Intergenic
954663343 3:52237665-52237687 AGGAGGCAGTTCCCTCCTGTGGG + Intronic
956755672 3:72383566-72383588 AGATGACAGTTCCTCCTTGAGGG - Intronic
959605786 3:108240402-108240424 GAAAGGCAGTTCCGTCCTGATGG - Intergenic
960782025 3:121330364-121330386 AGAAGGCAGTTCTCTGCTGCTGG - Intronic
962448572 3:135492131-135492153 CCAAGGCAGTTCCACCCTTAGGG - Intergenic
963411964 3:144939925-144939947 TGAAGACAGTCCTCCCCTGAAGG + Intergenic
965541460 3:169875544-169875566 AGAGGGTAGTTCCTCCCTGCAGG - Intergenic
966729539 3:183139001-183139023 AGAGGGCCTTTCTCCCCTGAAGG + Intronic
973695216 4:53483976-53483998 TGAAGGCAGGTCCCTCCTAAGGG + Intronic
979462909 4:121003763-121003785 AGAAGGGAGCTACCCCCTGTGGG + Intergenic
983543299 4:168935604-168935626 AGTAGGCAGTTATCCCCTCACGG + Intronic
986262034 5:6156001-6156023 AGAAAGCATTTCGCCTCTGAGGG + Intergenic
986378823 5:7162600-7162622 AGTAGGCAGTTTTCCCCTCACGG - Intergenic
990339484 5:54808421-54808443 AGAGAGCAGTTACCCTCTGATGG - Intergenic
992740607 5:79770099-79770121 AGTAGGCAGTTTTCCCCTCACGG - Intronic
996101563 5:119450310-119450332 AGAGGGCAGGTCCCCAGTGAGGG - Intergenic
998828266 5:146128638-146128660 AGTAGACTTTTCCCCCCTGATGG - Intronic
1001594695 5:172890759-172890781 AGAGGGAACTGCCCCCCTGATGG + Intronic
1002060563 5:176623398-176623420 AGAAAGCAGTTCCCCTTGGAGGG + Intronic
1007501019 6:42296911-42296933 AGAAGCCATTTCCTCCCTCAAGG + Intronic
1015772567 6:136784024-136784046 ATAGGGCAGTTCCCCTCTGGTGG - Intronic
1016549007 6:145255857-145255879 AGAGGGCAGGTCCCCAGTGAGGG - Intergenic
1017889163 6:158624988-158625010 AGAAGGGACTTCAACCCTGAAGG - Intronic
1021472303 7:21018420-21018442 AGATGTCAGTTCTCCTCTGATGG - Intergenic
1026638913 7:72107229-72107251 AGAATGCAGCTCCCCTCTGCAGG + Intronic
1027911725 7:84260502-84260524 AGAAAGCCTTTCACCCCTGAAGG + Intronic
1030875482 7:114808290-114808312 AGAAGACTGTGCCCCCCTCAGGG + Intergenic
1031115943 7:117668552-117668574 AGAAGGCAGTGTACCCTTGATGG - Exonic
1031248685 7:119350977-119350999 AGAAAGGAGCTACCCCCTGAGGG + Intergenic
1031689881 7:124774345-124774367 AGAAGGCATTTCTCCTCTTAAGG + Intergenic
1033959268 7:146893514-146893536 AAAATGCATTTCCCTCCTGAGGG - Intronic
1035816446 8:2546408-2546430 AGAAGGCAGGTCCCATCTGTAGG + Intergenic
1039919153 8:41881118-41881140 AGATGGCAGTTTCCTCATGAAGG + Intronic
1043999834 8:86865737-86865759 AGAGGGCAGTTCCCCAGTAAAGG - Intergenic
1049872362 8:144990606-144990628 AGTAGGCGGTTTTCCCCTGACGG - Intergenic
1050201334 9:3148805-3148827 AGTAGGCAGTTTTCCCCTCACGG - Intergenic
1051220381 9:14842645-14842667 AGAAACCCTTTCCCCCCTGAGGG + Exonic
1051814331 9:21087566-21087588 AGTAGGCAGTTTTCCCCTCACGG + Intergenic
1054715955 9:68557861-68557883 AGAAGGCTGTTACCTCCTTAGGG + Intergenic
1055512017 9:77004358-77004380 AGAGGGCATTTCCCCACTGCTGG - Intergenic
1055823884 9:80301074-80301096 AGTAGGCAGTTTTCCCCTCACGG - Intergenic
1056986506 9:91368310-91368332 AGAAGCCAGTTTCTCCCTGTTGG + Intergenic
1058603464 9:106696215-106696237 AGAAGTCAGTTCACTCCTGTAGG + Intergenic
1062575577 9:137205717-137205739 AGAAGGCAGTTCCCGCCGGCCGG - Exonic
1185982949 X:4799314-4799336 AGAAGGCAGTTCCCCAGCAAAGG - Intergenic
1187394631 X:18908546-18908568 AGAGGGCAGAGCCCTCCTGAAGG + Intronic
1189264376 X:39702453-39702475 AGCAAGCAGTTCCCCCTTCAGGG + Intergenic
1192984295 X:76380049-76380071 AGTAGGCAGTTTTCCCCTCACGG + Intergenic
1196458260 X:115904955-115904977 AGAAGGAAGTTCCCCCGGGTGGG - Intergenic
1201152876 Y:11103361-11103383 AGAACGCAGCTCCGCCCTCACGG - Intergenic
1201634254 Y:16104795-16104817 AGTAGGCAGTTCCCCGCCAAAGG + Intergenic