ID: 1181486876

View in Genome Browser
Species Human (GRCh38)
Location 22:23237140-23237162
Sequence CAGAGATTCAACTCACAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181486876_1181486878 0 Left 1181486876 22:23237140-23237162 CCTGTTTGTGAGTTGAATCTCTG No data
Right 1181486878 22:23237163-23237185 CAGAACTCACTTTTCCCAGGAGG 0: 1
1: 0
2: 0
3: 18
4: 212
1181486876_1181486877 -3 Left 1181486876 22:23237140-23237162 CCTGTTTGTGAGTTGAATCTCTG No data
Right 1181486877 22:23237160-23237182 CTGCAGAACTCACTTTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181486876 Original CRISPR CAGAGATTCAACTCACAAAC AGG (reversed) Intronic
No off target data available for this crispr