ID: 1181488165

View in Genome Browser
Species Human (GRCh38)
Location 22:23244689-23244711
Sequence CTCAGTAAGTACATTTGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 141}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181488162_1181488165 6 Left 1181488162 22:23244660-23244682 CCAGCACAGTGTCCTGCACGTAT 0: 1
1: 0
2: 0
3: 18
4: 155
Right 1181488165 22:23244689-23244711 CTCAGTAAGTACATTTGTCTGGG 0: 1
1: 0
2: 0
3: 12
4: 141
1181488161_1181488165 7 Left 1181488161 22:23244659-23244681 CCCAGCACAGTGTCCTGCACGTA 0: 1
1: 0
2: 17
3: 128
4: 839
Right 1181488165 22:23244689-23244711 CTCAGTAAGTACATTTGTCTGGG 0: 1
1: 0
2: 0
3: 12
4: 141
1181488159_1181488165 17 Left 1181488159 22:23244649-23244671 CCATTCCATACCCAGCACAGTGT 0: 1
1: 0
2: 2
3: 24
4: 236
Right 1181488165 22:23244689-23244711 CTCAGTAAGTACATTTGTCTGGG 0: 1
1: 0
2: 0
3: 12
4: 141
1181488163_1181488165 -6 Left 1181488163 22:23244672-23244694 CCTGCACGTATTAGATACTCAGT 0: 1
1: 0
2: 6
3: 54
4: 303
Right 1181488165 22:23244689-23244711 CTCAGTAAGTACATTTGTCTGGG 0: 1
1: 0
2: 0
3: 12
4: 141
1181488160_1181488165 12 Left 1181488160 22:23244654-23244676 CCATACCCAGCACAGTGTCCTGC 0: 1
1: 0
2: 0
3: 44
4: 318
Right 1181488165 22:23244689-23244711 CTCAGTAAGTACATTTGTCTGGG 0: 1
1: 0
2: 0
3: 12
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181488165 Original CRISPR CTCAGTAAGTACATTTGTCT GGG Intronic
900911308 1:5598798-5598820 ATCAGGAAGTATATTTGTCAAGG - Intergenic
907380483 1:54083223-54083245 CTCAGTGAGAACCTTTGGCTAGG + Intronic
909086995 1:71180258-71180280 TTCAGTAAGTTCATTTGTATGGG - Intergenic
909211188 1:72826722-72826744 CTCATAAAGGATATTTGTCTGGG - Intergenic
910557618 1:88553357-88553379 CCCAGAAAGTACATTTGACTTGG + Intergenic
911941614 1:104054726-104054748 CTGAGCCTGTACATTTGTCTGGG + Intergenic
911987654 1:104650380-104650402 CTCAGTAACATTATTTGTCTTGG - Intergenic
916799217 1:168199506-168199528 CTTAGTATGTACTTCTGTCTGGG + Intronic
917230501 1:172832243-172832265 CTCTATAAGTATATTTCTCTTGG - Intergenic
917500027 1:175577558-175577580 CTCAGGAAGTACAAGTGGCTTGG + Intronic
919444010 1:197678190-197678212 CTCTGTAATTACATGTGTCATGG - Intronic
919797261 1:201328625-201328647 ATCACTAAGTACATGTGTCAGGG - Intronic
920606016 1:207386515-207386537 CTCAGTAGGTATATATGTCTAGG - Intergenic
1063698702 10:8363863-8363885 CTCAGAAAGGAGATTTGTGTTGG + Intergenic
1064260202 10:13779367-13779389 CTCAGTAAGGAATTTTCTCTTGG - Intronic
1066463645 10:35634313-35634335 TTCAGTAAGCACAGTTGTTTTGG + Intergenic
1072233159 10:93430227-93430249 CTCAATAAGTACATCTTGCTGGG - Intronic
1075870302 10:125767901-125767923 CCCAGGAAGTGCATTTTTCTTGG + Intronic
1076535842 10:131176417-131176439 CTCTGTGTGTACATGTGTCTTGG - Intronic
1076535851 10:131176641-131176663 CTCTGTGTGTACATGTGTCTTGG - Intronic
1079498189 11:21070091-21070113 CTCAGTAAGTAGGTTAGTCGAGG - Intronic
1079756131 11:24266042-24266064 CTTAGTAGGGACATTTGTCATGG - Intergenic
1079772806 11:24484813-24484835 TTCAGTAAACACATTTTTCTAGG - Intergenic
1080172687 11:29324750-29324772 CTCACAAAGTACATTTGATTTGG + Intergenic
1080959696 11:37144546-37144568 TTCAGTAAGTAGATTTTTGTAGG + Intergenic
1085648932 11:78249627-78249649 CTCAGTAGACACATATGTCTAGG - Intronic
1085887107 11:80533725-80533747 CTAAGGAAGTCCATTTGTCTTGG + Intergenic
1087916225 11:103814663-103814685 CTCTGTAAATAGATTTTTCTAGG + Intergenic
1091087747 11:132739318-132739340 CTCTGTAAATACATTTTTATGGG + Intronic
1091384122 12:81493-81515 CTCAGGAAGTACTGTTGTCTTGG - Intronic
1091559942 12:1604606-1604628 CTCATAAAGTACCTTTGGCTTGG + Intronic
1094883177 12:34820065-34820087 CTCAGTAACTTCCTTTGTGTGGG + Intergenic
1100196531 12:92252688-92252710 CTTAGCAAGTAAATTTGTTTAGG - Intergenic
1102338636 12:112104085-112104107 CTGAGTTAGGACATTTCTCTTGG - Intronic
1106152060 13:27114122-27114144 CTCAGTAAGTCCATTTGTGAGGG - Intronic
1106388473 13:29311883-29311905 CTTAGTAAGAATATTTGCCTTGG + Intronic
1106645246 13:31627312-31627334 TTCAGGAAGTATATTTTTCTTGG - Intergenic
1107578181 13:41750137-41750159 CCCATTAAGAACATTTGGCTTGG + Intronic
1114937392 14:27558078-27558100 CTTAGAAAGTACAATTGTTTTGG - Intergenic
1116374329 14:44178879-44178901 CACAGAAAGTACATTAGTGTGGG + Intergenic
1117641764 14:57807601-57807623 ATCAGTCAGTAGATTTGGCTTGG - Intronic
1119448165 14:74684140-74684162 TTCTTTAAATACATTTGTCTTGG - Intronic
1119896345 14:78222909-78222931 CTCAATAAATACATTTGAGTGGG + Intergenic
1120037683 14:79716427-79716449 TTTAGCATGTACATTTGTCTAGG + Intronic
1122383189 14:101324790-101324812 CTAGGTAAGTACATTCCTCTGGG - Intergenic
1126326748 15:47486715-47486737 CTGAGTACGTACATTTTTATAGG + Intronic
1126977191 15:54197179-54197201 TTTAATAAGTACATTTGGCTGGG + Intronic
1127604517 15:60573005-60573027 CTGAGTAAGTACATGAGTGTGGG + Intronic
1128824279 15:70697127-70697149 CTCAGTAGTAACATTTGTCCAGG - Intronic
1133068787 16:3231503-3231525 CTCAGTAAAGACATTTGTGCGGG + Intronic
1135474002 16:22757404-22757426 CTCAGTAGGTTCATTTTTCCTGG + Intergenic
1138036730 16:53614781-53614803 CTCAGAAATCACATTTGTTTAGG + Intronic
1138896069 16:61206226-61206248 CTCAGTAACAAAATCTGTCTTGG - Intergenic
1140292646 16:73675451-73675473 CTCAGTAAATCCATTTGTAATGG - Intergenic
1140802775 16:78504338-78504360 CTCAGAAAGTACCTTTCTCCTGG - Intronic
1144245454 17:13359177-13359199 CTCAGGAGGTCCACTTGTCTAGG - Intergenic
1145984940 17:29039469-29039491 CTCAGATAGTACATTTTTCTCGG + Intronic
1146733800 17:35219366-35219388 CTCATTAAATTCATTTGTTTTGG + Intergenic
1147961832 17:44172244-44172266 CTCAGTCAGCACATTAGCCTTGG - Exonic
1151076968 17:71284973-71284995 CTCAGTAAATCCATATGACTAGG - Intergenic
1151130393 17:71890727-71890749 CTCTGTAAGGACTTTTGTCCAGG - Intergenic
1155730613 18:29153132-29153154 CTGAGGAAGTACATTAGTCTGGG + Intergenic
1159907930 18:74114987-74115009 CTCAGTAAGAAGCTGTGTCTAGG - Intronic
1160354722 18:78217116-78217138 CCCACTAGGCACATTTGTCTGGG + Intergenic
1163339963 19:16699305-16699327 CTCAGTAACTTCCTTGGTCTTGG + Intergenic
1163951686 19:20593926-20593948 CTAAATAAGTACATTTGTAATGG - Intronic
1164744311 19:30599766-30599788 TTCACAAAGCACATTTGTCTAGG + Intronic
1168165106 19:54541838-54541860 CTCAGAAAGTGTATTTGTCCTGG + Intronic
1168199155 19:54801723-54801745 CTCATTAATTAAATTTGTTTTGG + Intronic
1168586480 19:57598011-57598033 GTCTATAAGTACATTTGGCTTGG - Intergenic
925699580 2:6621957-6621979 TTCAGTAATTATATTTTTCTAGG + Intergenic
925869711 2:8259159-8259181 CTCACTAGGTGCATTCGTCTAGG - Intergenic
927135193 2:20091864-20091886 CTCAGGAATTCCATTTCTCTTGG - Intergenic
928619098 2:33070892-33070914 CCCAGTCAGTTCATTTCTCTGGG + Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929207958 2:39319742-39319764 CTTTGTAATTTCATTTGTCTAGG - Intronic
932463403 2:71897822-71897844 CTAAATAAGCACATTTGACTAGG + Intergenic
933400522 2:81790837-81790859 CTCAATAAGGAAATTTGTCTTGG + Intergenic
939206816 2:139116889-139116911 CTCAGTAAGAATATTTATTTTGG + Intergenic
939672604 2:145031853-145031875 CTCACTAAATACTTTTGGCTTGG - Intergenic
941110181 2:161413265-161413287 CTCAGTGAACACCTTTGTCTTGG + Intergenic
942146014 2:173027256-173027278 CCCAGTAAGTATATTTAGCTTGG + Exonic
944405671 2:199380804-199380826 CACAATAATTACATTTGTATTGG - Intronic
945458275 2:210073591-210073613 CTCAATAGCTACATGTGTCTAGG + Intronic
946167801 2:217876018-217876040 CTCAGAAAGTAGATTTCTCAGGG - Intronic
947343839 2:229170124-229170146 CTCAGGAAGTACATGCGACTTGG - Intronic
1171419601 20:25008968-25008990 CTCAGTAAGCTCACATGTCTGGG - Intronic
1173311872 20:41904096-41904118 GTAAGTAAGTTCTTTTGTCTTGG + Intergenic
1175580614 20:60095975-60095997 GTCAGTAGGTACATGTGACTTGG - Intergenic
1179066526 21:38029746-38029768 CTCATTATGTACAGTTCTCTGGG - Intronic
1181488165 22:23244689-23244711 CTCAGTAAGTACATTTGTCTGGG + Intronic
1182238632 22:28896685-28896707 TTCAGAAAGTACATCAGTCTTGG + Intronic
1183186972 22:36297647-36297669 ATGTGTAAGGACATTTGTCTAGG + Intronic
1184938343 22:47741205-47741227 CTCAGAAAGTAACTTTCTCTTGG + Intergenic
949392915 3:3582677-3582699 GGCAGTACATACATTTGTCTTGG - Intergenic
949584105 3:5421034-5421056 CTCAGTAAATACAGTTGTTTTGG + Intergenic
950824645 3:15805000-15805022 CTACGTAAGTACATGTGTGTTGG - Intronic
951069254 3:18307091-18307113 CTCAGAAAGTAGATTTGTATTGG + Intronic
951123055 3:18951008-18951030 TTCAGTAAGTACATGTTCCTGGG + Intergenic
951927135 3:27920761-27920783 GTGAGTGAGTACATTTGTGTTGG + Intergenic
955105939 3:55897978-55898000 CACATTAAGAACATTTGTTTGGG + Intronic
957795530 3:85000819-85000841 CTATGTATGTACATTTGTATAGG + Intronic
960372410 3:116857062-116857084 CTCAGAATGTACTTTTGTATTGG + Intronic
963197541 3:142549695-142549717 ACCAAAAAGTACATTTGTCTGGG + Intronic
963369626 3:144382296-144382318 CTCAGGAAGTACTTTGGACTTGG + Intergenic
964971743 3:162571686-162571708 TTCAGTAAATACATTTATGTAGG + Intergenic
967022009 3:185530995-185531017 CTCAGTTTATACCTTTGTCTTGG - Intronic
967585587 3:191210420-191210442 CTTAATAACTACATTTGTTTTGG - Intronic
971411495 4:26377691-26377713 CTCAGTAAGCAAATTTCACTAGG - Intronic
972205391 4:36765909-36765931 CACTGTAAGAACAATTGTCTTGG + Intergenic
974686190 4:65233375-65233397 CTGAAGAAGTAGATTTGTCTTGG - Intergenic
980462368 4:133132238-133132260 CTTAGTAAATACAATTATCTGGG + Intergenic
982728093 4:158927252-158927274 CTCTGTAACAACTTTTGTCTTGG + Intronic
982731157 4:158956831-158956853 CTCCATAATTACATTTGTTTTGG + Intronic
982890770 4:160847164-160847186 CTCAGAAAGTATATTTCACTTGG + Intergenic
982989465 4:162253076-162253098 CTTAATAAGTTCATTTATCTGGG + Intergenic
983159178 4:164389450-164389472 CTCAGAAAATATATTTGTCAGGG - Intergenic
995312501 5:110730028-110730050 CTCACTAGGTAGATTTCTCTAGG - Intronic
996478206 5:123945245-123945267 CTGAACAAGTACATTTGGCTTGG - Intergenic
1002842336 6:916949-916971 GTCAATAAGAACATTTGTATAGG - Intergenic
1003141508 6:3475293-3475315 CTGATTATGTGCATTTGTCTGGG + Intergenic
1003875092 6:10428481-10428503 CTCAGTATATACATTTGTACTGG - Intergenic
1004154570 6:13156129-13156151 CTGAGTAAGTTCATTTTGCTAGG + Intronic
1005018560 6:21396269-21396291 CTCATGAAGTTCATTTTTCTTGG + Intergenic
1011414313 6:87101620-87101642 CTCAGAAAGTACATTTATCCTGG - Intergenic
1012267597 6:97164912-97164934 CACAGTAATTATATTTGGCTGGG - Intronic
1013574214 6:111464766-111464788 CTCAGGAAGTCCACCTGTCTAGG - Intronic
1013737636 6:113246376-113246398 CTGATGAAATACATTTGTCTGGG + Intergenic
1014827173 6:126059796-126059818 GACAGTAAGTACGTTTCTCTAGG + Intergenic
1015694264 6:135962800-135962822 CTCAGGAATTCCATTTGTTTGGG - Intronic
1016192724 6:141290244-141290266 CACAGTAAGTACAATTTTATTGG - Intergenic
1016345323 6:143106816-143106838 ATCTGTAAGTACCTTTATCTTGG - Intronic
1018737617 6:166699644-166699666 CCCAGTATGTACAATTGTGTTGG - Intronic
1021700145 7:23310912-23310934 CCCAGTACGTACAATTGTGTTGG - Exonic
1024316757 7:48027044-48027066 CCCATTAAGTAGGTTTGTCTGGG + Intronic
1033968973 7:147014190-147014212 CTGAGAAAATACATTTGTTTTGG - Intronic
1039214504 8:35254518-35254540 CTCAGTAAGTGTAATGGTCTTGG - Intronic
1039994599 8:42520784-42520806 CTCAGACAGTACATTTGGATGGG - Intronic
1040928612 8:52711805-52711827 TTCAGTAACTTCATTTTTCTTGG + Intronic
1041172111 8:55154493-55154515 GGCATTAAGTACATTTTTCTTGG - Intronic
1046069674 8:109235169-109235191 GTCAGTAGATACATTTTTCTAGG + Intergenic
1050207551 9:3213115-3213137 CACAGTAACTACATTTTTATGGG - Intergenic
1050299655 9:4244260-4244282 CACAGTAAATACACTTGGCTAGG + Intronic
1050504571 9:6334360-6334382 CTCTGTCAGTGCATTTTTCTTGG - Intergenic
1051068593 9:13135338-13135360 CTCAGTGAGTACATTTAGTTGGG + Intronic
1052202440 9:25799253-25799275 ATCAGTAAGTACCTTGATCTTGG - Intergenic
1057954053 9:99393283-99393305 CTCAGTCAATACATTCCTCTGGG - Intergenic
1186952466 X:14642238-14642260 CTCATTAAGTCCATCTGCCTGGG + Intronic
1193742847 X:85239376-85239398 CACAGTATGTCCATTTGTTTAGG - Intergenic
1194330790 X:92581003-92581025 CTCACTGAGTTCATTTTTCTTGG + Intronic
1194900730 X:99507692-99507714 TTCACTAAGTGCATTTGTGTAGG + Intergenic
1195077472 X:101340865-101340887 CTCACAAAGTACACTTCTCTGGG - Intergenic
1196292537 X:113960269-113960291 CTTATTAAGGACCTTTGTCTTGG + Intergenic
1200639494 Y:5700073-5700095 CTCACTGAGTTCATTTTTCTTGG + Intronic