ID: 1181490128

View in Genome Browser
Species Human (GRCh38)
Location 22:23256383-23256405
Sequence TTCCCACAGCACCCCGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 210}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181490128_1181490133 -6 Left 1181490128 22:23256383-23256405 CCTTGCCCGGGGTGCTGTGGGAA 0: 1
1: 0
2: 1
3: 24
4: 210
Right 1181490133 22:23256400-23256422 TGGGAAGGATTCACACAGGCTGG 0: 1
1: 0
2: 0
3: 31
4: 314
1181490128_1181490132 -10 Left 1181490128 22:23256383-23256405 CCTTGCCCGGGGTGCTGTGGGAA 0: 1
1: 0
2: 1
3: 24
4: 210
Right 1181490132 22:23256396-23256418 GCTGTGGGAAGGATTCACACAGG 0: 1
1: 0
2: 3
3: 14
4: 171
1181490128_1181490135 21 Left 1181490128 22:23256383-23256405 CCTTGCCCGGGGTGCTGTGGGAA 0: 1
1: 0
2: 1
3: 24
4: 210
Right 1181490135 22:23256427-23256449 TTGCGACAACCTGCAGCCCCAGG 0: 1
1: 0
2: 0
3: 10
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181490128 Original CRISPR TTCCCACAGCACCCCGGGCA AGG (reversed) Intronic
900214450 1:1473915-1473937 GTTCCCCAGCACCCCGGGGAAGG - Intronic
900555998 1:3280845-3280867 TTCTCACAGCCCCTGGGGCAGGG + Intronic
900573678 1:3372516-3372538 CTCCCGCCTCACCCCGGGCAAGG + Intronic
900874529 1:5331957-5331979 ATCCCACAACAGGCCGGGCACGG - Intergenic
901416737 1:9121726-9121748 TTCCCACTGCCCCCAGAGCAGGG + Intronic
901527808 1:9835284-9835306 ATCCCACAACCCCCAGGGCATGG + Intergenic
901650137 1:10738418-10738440 TGCCCACAGCAGGCCGGGGAAGG + Intronic
901677068 1:10891665-10891687 ATCCCACAGCCAGCCGGGCACGG + Intergenic
901922156 1:12545074-12545096 TTCCCACAGTTCCCCAGCCAGGG - Intergenic
902518360 1:17001983-17002005 GTCACACAGCACGCCAGGCAGGG + Intronic
902771964 1:18650351-18650373 GTCACACAGCAAGCCGGGCAGGG - Intronic
903951036 1:26996089-26996111 CTCCCACAGTACCCTGGGCAGGG + Intronic
904422667 1:30404300-30404322 ACCCCACAGCACACAGGGCAGGG + Intergenic
904987651 1:34565136-34565158 TACCCACATCACCCATGGCAGGG + Intergenic
905468785 1:38176020-38176042 TGCCCCCATCACCCAGGGCATGG - Intergenic
907591216 1:55673390-55673412 TTCCAACAGCAGCCCTGGCGGGG + Intergenic
911733379 1:101312235-101312257 TTCCTCCAGCAGCCTGGGCAAGG + Intergenic
912439234 1:109686202-109686224 TCCCCACAGGACCACAGGCAGGG - Intronic
916205679 1:162314181-162314203 TTATCACAGCCCCCAGGGCAGGG + Intronic
916308055 1:163361852-163361874 TTGGCACAGCACCCAGTGCATGG + Intergenic
916851868 1:168712300-168712322 TCCCCACTGCAGCCCGTGCAGGG + Intronic
917329728 1:173868611-173868633 CTCCCTCAGGACCCCGGGAAGGG + Intronic
917626780 1:176854305-176854327 TTCCCACAGAACCTGGGGCCAGG - Intergenic
918114640 1:181485478-181485500 CTCCCACAGCAACCCCGGCTGGG + Intronic
918415106 1:184298409-184298431 TTCCCACAGCACACAGGACACGG + Intergenic
920341754 1:205279557-205279579 TTCCCACAGCCCCCAGGGCTTGG - Intergenic
920734323 1:208517040-208517062 TGCACACAGCACCCTGGGCCTGG + Intergenic
921822154 1:219629616-219629638 TTACCACAGCAACCCAGGGAAGG + Intergenic
922934022 1:229410188-229410210 CTCCCCCAACACCCCAGGCATGG + Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
1063174728 10:3540936-3540958 TTCCCACAGCAACAAGGGCTGGG - Intergenic
1065466541 10:26030124-26030146 TTCCCACCACACCTCGGTCAAGG + Intronic
1066374290 10:34843572-34843594 TTCACACAGCACACAGGGCTGGG - Intergenic
1066374297 10:34843615-34843637 TTCACACAGCACACAGGGCTGGG - Intergenic
1066374304 10:34843658-34843680 TTCACACAGCACACAGGGCTGGG - Intergenic
1067296616 10:44978427-44978449 TTCCTACAACATCCCGGCCAGGG - Intronic
1069526899 10:69180392-69180414 TTGCCCCAGAACCCCGGGAAAGG - Exonic
1069550498 10:69360664-69360686 TGCCCACAGCCCCTTGGGCAGGG - Intronic
1069738537 10:70672952-70672974 TTGCCCCAGCCACCCGGGCAGGG + Intronic
1070295129 10:75154054-75154076 TTACTACAGCTCACCGGGCATGG - Intronic
1070678965 10:78435405-78435427 TTCCCAAAGGACACAGGGCAGGG - Intergenic
1072488171 10:95875887-95875909 TTCCCACAGGACCCAGGGGGAGG - Exonic
1074864566 10:117537311-117537333 TTCCTACTCCACCCCAGGCAGGG + Intergenic
1076076890 10:127540430-127540452 TGCCCACATCCCCTCGGGCAAGG - Intergenic
1077059553 11:611834-611856 TCCCGACAGCTCCCCGGGCATGG - Exonic
1077059567 11:611873-611895 TCCCGACAGCTCCCCGGGCATGG - Exonic
1077234584 11:1473846-1473868 TGCCCCCAGCACCCCGGGGATGG + Intronic
1078110858 11:8390704-8390726 TTCCCACCTCACACCAGGCAAGG - Intergenic
1078386163 11:10894799-10894821 TTCCCCCAGCACCCCTTGCAAGG - Intergenic
1079450942 11:20599286-20599308 GTCCCACTGCACCCAAGGCAAGG - Intergenic
1083721854 11:64607420-64607442 GTCCAGCAGCACCACGGGCATGG - Exonic
1083946244 11:65924698-65924720 GTCCAGCAGCACCCAGGGCAGGG - Intergenic
1083955066 11:65978471-65978493 TTCCCACTGCACCCCAGGCCTGG + Intronic
1084477880 11:69399066-69399088 TGCCCACAGCAGGCTGGGCACGG + Intergenic
1084567556 11:69940020-69940042 TTCTCACAGCACACAGGCCAGGG - Intergenic
1084709621 11:70835945-70835967 AGCCCACTGCACCCCGAGCAGGG + Intronic
1085053318 11:73390746-73390768 CTCCCACAGGACCCAGGGCAGGG + Exonic
1085344973 11:75762849-75762871 TACCCACAGCACCCAGCACAAGG + Intronic
1085415229 11:76315274-76315296 TCCCCACACCTCCCTGGGCAGGG + Intergenic
1085811911 11:79690822-79690844 TTCCTACACCTCCCCTGGCAGGG - Intergenic
1087081670 11:94176914-94176936 TCCTCACAGCAACCCTGGCAGGG - Intronic
1087175472 11:95091197-95091219 TTCCCCCAGCAGCCTGGGCAGGG - Intronic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1093374767 12:18411248-18411270 TTTCTACAGCACCCCTAGCAAGG - Intronic
1094422743 12:30288928-30288950 TTCCCACAGCACAGCAAGCAAGG + Intergenic
1096649188 12:53053543-53053565 TACCCACAGCACTCCGTTCAAGG - Intronic
1099054941 12:77827766-77827788 TTCTCACAGCACCCCTGTGAAGG + Intergenic
1100208177 12:92374129-92374151 TTCCCCCAGCACCACTGGTAAGG + Intergenic
1104344697 12:127984938-127984960 TTCCAACAGCAGCCTGGGGAGGG + Intergenic
1104875562 12:132031843-132031865 ATCCCACAGCAGGCCGGGCGTGG - Intronic
1105916619 13:24922865-24922887 TTCCCACAGGACCTCGGGACGGG - Exonic
1108623520 13:52206170-52206192 TTCCCACAGCCCCAAGGGGATGG + Intergenic
1110573354 13:77029236-77029258 TTCCCACACCACCCCAGCCTTGG + Intergenic
1113499074 13:110759260-110759282 GTCCCACCGCACTCCAGGCAGGG - Intergenic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1113795630 13:113056080-113056102 TTCCCACAGGACCCCTCCCATGG - Intronic
1113847629 13:113401635-113401657 TCCCCACAGCTCCCCCGACAGGG - Intergenic
1119739538 14:77005279-77005301 CTCCCCCAGCAGCCCAGGCAAGG + Intergenic
1121644425 14:95508058-95508080 AGCCCACAGCACTCCTGGCATGG + Intergenic
1122312066 14:100803775-100803797 TTCCCACAGCCTCCCGGCCAGGG - Intergenic
1122695925 14:103552051-103552073 TTCCAACAGCACCGAGGACATGG + Intergenic
1123718066 15:23044055-23044077 TCCCCCCAGCACCCCTGGCCAGG - Intergenic
1123718944 15:23047120-23047142 TCCCCCCAGCACCCCTGGCCAGG - Intergenic
1123719158 15:23047863-23047885 TCCCCCCAGCACCCCTGGCCAGG - Intergenic
1124042534 15:26118541-26118563 TTCCCACATCACCCCAGGGCTGG - Intergenic
1128249130 15:66152533-66152555 TACCCACAGGACCCCTGGCAAGG - Intronic
1128942836 15:71802448-71802470 TGCCCACAGGGCCCCGGGCAGGG + Intronic
1129617077 15:77107080-77107102 TTCACACAGCAGCCCGGTCCTGG + Exonic
1130397291 15:83513708-83513730 TTCCCACTCTACCCAGGGCATGG + Intronic
1131669280 15:94601954-94601976 ATCCCACAGCATCCCAGGAACGG - Intergenic
1132390301 15:101433772-101433794 TCCCCACATCACCCTGAGCAAGG + Intronic
1132505600 16:306961-306983 TTCCCGCTGCACCCGGGGCCTGG + Intronic
1132554430 16:566328-566350 TCCCCACAGCACTCCGCGCCTGG - Intergenic
1134537814 16:15040743-15040765 TCCCCCCAGCACCCCAGGCCCGG - Intronic
1135333382 16:21580475-21580497 ATCCCACTGCACCCCGGCCTGGG + Intergenic
1135964916 16:27027855-27027877 TTGCCACACATCCCCGGGCAGGG - Intergenic
1136348229 16:29690581-29690603 TTCCCGCAGCATCCTGGGAAAGG - Intronic
1136552172 16:30987634-30987656 TCCCCACAGCAGCCTGGGAAAGG - Intronic
1137267935 16:46884215-46884237 GTCCCACAGCGCCCCGCGCCGGG - Intergenic
1140155897 16:72426364-72426386 TGCCCAGATCACCCCTGGCACGG - Intergenic
1140774301 16:78235897-78235919 TACCCACAGGAGCCTGGGCATGG + Intronic
1141523446 16:84596625-84596647 TTCCCACGGCACCCAGGGCATGG + Intronic
1142001808 16:87668576-87668598 TTCCCACCGGACCCTTGGCAAGG - Intronic
1142743493 17:1943447-1943469 TCCCCGCAGCCCCCTGGGCAGGG + Intronic
1142905019 17:3035581-3035603 TTCCAACAGCAAACCGGGCATGG - Exonic
1143486684 17:7259148-7259170 TCCCCAGAGCACCCTGGGCCTGG + Intronic
1143912716 17:10265193-10265215 TCCCCACAGCAGCCTAGGCAAGG - Intergenic
1146750385 17:35373429-35373451 TTCCCACCCCACCCCAGCCAGGG - Intronic
1147217875 17:38911535-38911557 TTCCCCCACCACCCCAGCCAGGG + Intronic
1147335917 17:39726946-39726968 TGCCCCCAGCGCCCGGGGCAGGG - Exonic
1148322708 17:46767156-46767178 GTTCCACAGCACCCCGGGATAGG - Intronic
1151539413 17:74757589-74757611 GTCACACAGCACTCCAGGCAGGG + Intronic
1152299140 17:79485221-79485243 TTCCCAGAGCAGTCCTGGCAGGG + Intronic
1152634104 17:81423446-81423468 TTCCCCCTGCCTCCCGGGCAGGG + Intronic
1154167038 18:12023508-12023530 TTCCTACACCAGCCCTGGCATGG + Intronic
1155074330 18:22341760-22341782 TTCCCATAGCACCCTGTACATGG - Intergenic
1160394157 18:78559642-78559664 CTACCACAGCTCCCCAGGCAGGG - Intergenic
1160961807 19:1725509-1725531 CTCCCCCAGCACCCAGGCCAGGG - Intergenic
1161358872 19:3834869-3834891 TTCCCCCAGCTGCCCCGGCAGGG - Exonic
1161592234 19:5134083-5134105 GTCCCAGAGAACCCCAGGCAGGG + Intronic
1161719315 19:5894425-5894447 TTCCCCCAGTTCCCAGGGCAGGG - Intronic
1162551671 19:11361582-11361604 TTCCAACAGCACCCGGGGCGTGG - Intronic
1163345651 19:16740376-16740398 TTCCCACTGCACCCCAGCCTGGG - Intronic
1163813000 19:19445984-19446006 TTCCCACATGAGCCTGGGCAGGG - Intronic
1163825896 19:19524761-19524783 TTGCCACTGCACCCCAGCCAGGG + Intronic
1163829537 19:19541123-19541145 GGCCCACAGCTCCCCGAGCAGGG - Exonic
1164785361 19:30926325-30926347 TTCCCACAGCCCTCCAGCCATGG + Intergenic
1165474325 19:36021325-36021347 GTGCCACTGCACCCCTGGCATGG - Intronic
1166113895 19:40640907-40640929 TTCCCAGCGGAGCCCGGGCAGGG + Intergenic
1166688755 19:44810662-44810684 TGCCTCCAGCACCCTGGGCAGGG - Intronic
1168104173 19:54156567-54156589 ACACCACAGCACCCCGGGAAAGG + Intronic
1168137552 19:54361451-54361473 TTCCCACATGACCCTGAGCAAGG - Intronic
1168147870 19:54429806-54429828 CTCCCACAGCACCCAGTGCCTGG - Intronic
1168435975 19:56317267-56317289 TTACTAAAGCACCCAGGGCAAGG - Intronic
925308271 2:2865273-2865295 TCCCCACACCACCCCAGACAGGG - Intergenic
926336750 2:11869004-11869026 CTCCCACAGCACCGAGGGAAAGG + Intergenic
926630896 2:15135454-15135476 CTCCCACTGCACCCCAAGCACGG - Intergenic
927913369 2:26917247-26917269 TTACCACATCATCCAGGGCATGG - Intronic
927926792 2:27019239-27019261 ATCCTACAGCACCCTGGGCACGG - Intronic
928184458 2:29097150-29097172 TTGCCACATCACCCAGGGCAAGG - Intergenic
929760829 2:44805098-44805120 TTCCCAGAGCTCTCTGGGCAGGG - Intergenic
931173936 2:59834027-59834049 CTCCCTCAGCACCCCAGGCTGGG + Intergenic
933637074 2:84720178-84720200 TTCCCACACCACCCATGGCCAGG - Intronic
933897446 2:86824573-86824595 TCCCCACAGGACCCCAGGAAGGG - Intronic
934554040 2:95278114-95278136 ACCACACAGCACCCTGGGCAGGG + Intronic
934718127 2:96554890-96554912 TTCCCAGAGGCCCCAGGGCATGG - Intergenic
935332267 2:101985844-101985866 TACCCTCATCACCCCGGGCCAGG - Intergenic
936065961 2:109332402-109332424 CTCCCCCAGCACCCCGAGCAGGG + Intronic
937317893 2:120943612-120943634 GTCCCAAAGCACCAGGGGCATGG - Intronic
937678436 2:124617846-124617868 TTCCCACTGCACACCAGGCTAGG - Intronic
937705407 2:124914713-124914735 TTACCATAGAACCCAGGGCAGGG + Exonic
937895315 2:126973333-126973355 TTCCCTCAGCAACCCTGGGAGGG + Intergenic
937958652 2:127438183-127438205 TACCCACAGCCTCCCCGGCATGG - Intronic
938494490 2:131786387-131786409 ATCCCACTGCAGCCTGGGCATGG + Intergenic
946225389 2:218261618-218261640 TTCCCCCAGCACCCTGAGCCTGG - Intronic
1172474289 20:35226169-35226191 TTCCCCCACCACCCCGGCCCAGG + Intergenic
1174420335 20:50395379-50395401 CTCCCACAAGGCCCCGGGCAGGG + Intergenic
1174960357 20:55149629-55149651 TTGCCATAGCACCCAGTGCAAGG + Intergenic
1175222724 20:57426626-57426648 CTCCCACAGCACCCCCAGGAGGG + Intergenic
1181490128 22:23256383-23256405 TTCCCACAGCACCCCGGGCAAGG - Intronic
1182902630 22:33911046-33911068 TTCTCACAGCAACCCTGGGAGGG - Intronic
1183516818 22:38271791-38271813 TACGCACAGCACCCTAGGCAAGG + Intronic
950432362 3:12958222-12958244 TGCCCACAGCACCCAGCACAGGG + Intronic
952125328 3:30293016-30293038 TTCCCACAGCACAAAGGGCTGGG + Intergenic
952819474 3:37473467-37473489 TTCCCACAGCACCCCCAGGAGGG - Intronic
953885412 3:46712184-46712206 CACCCACAGCAACCTGGGCACGG + Exonic
954423585 3:50431593-50431615 TTCTCACAGCAACCCGGAGAAGG - Intronic
954610290 3:51941568-51941590 TTCCCTCAGAACCCCAGGAATGG + Intronic
956058131 3:65322244-65322266 TTCCCGGAGCACACCAGGCATGG - Intergenic
963080010 3:141382759-141382781 TTCCCACAGTTCCCAGGGCCTGG + Intronic
964922315 3:161912252-161912274 TTGCTACAGGACCCCAGGCAAGG + Intergenic
967873657 3:194251917-194251939 TCCCCACAGCACCCAGAACAAGG - Intergenic
968289278 3:197526253-197526275 TTCCCACAGCCCTCAGGGCTGGG - Intronic
968494519 4:907938-907960 TTCCCACACCACCCCATGCAGGG + Intronic
969611506 4:8229846-8229868 ATCCCCCAGCACCCCGGGGAGGG - Intronic
972100065 4:35404249-35404271 TTACGACAGCACCCTGAGCAAGG - Intergenic
972670975 4:41214057-41214079 TTCCCTCAGCAGCCCCGGCTTGG - Intronic
973955363 4:56058110-56058132 GTGCCACTGCACCCCTGGCACGG - Intergenic
977265635 4:94850060-94850082 CTCCCACAGCACCATGGACATGG + Intronic
977848243 4:101791227-101791249 TTTCCCCAGCACCCGGGTCAGGG + Intronic
983410051 4:167385222-167385244 TTTCCACTGAACCTCGGGCAAGG + Intergenic
985747744 5:1656673-1656695 TTCCCCCAACACCACGGACAGGG - Intergenic
986136451 5:4984027-4984049 TTCCCCCAGCAGCCCCAGCAGGG + Intergenic
986237184 5:5922430-5922452 GTCCCACAGCACCCCTGATATGG + Intergenic
993701240 5:91121390-91121412 TAGCCACTGCACCCCTGGCACGG - Intronic
999104238 5:149055789-149055811 TTAACACAGCAAACCGGGCATGG + Intronic
1000636831 5:163654217-163654239 TTCCCAGAGCACCTCTGGAATGG - Intergenic
1000842535 5:166238844-166238866 ATCCCACAGCAGGCCAGGCATGG + Intergenic
1001131680 5:169069509-169069531 TTCCCTCGGCACCCAGGGTAGGG - Intronic
1002001699 5:176199799-176199821 TTTCCACTGCACAGCGGGCAAGG + Intergenic
1002053908 5:176587571-176587593 TTCCCACACCACCGAGGGCTGGG + Intronic
1002252640 5:177939184-177939206 TTTCCACTGCACAGCGGGCAAGG - Intergenic
1002332399 5:178453431-178453453 TTACAACAGCACCACAGGCACGG - Intronic
1006429153 6:33984503-33984525 TTCCCCCAGCGCCCCTGGCCTGG - Intergenic
1007662768 6:43496646-43496668 TTCCAACAGGGCCCGGGGCAGGG - Intronic
1010348496 6:74841859-74841881 TTCCCACAGCTTCTCAGGCATGG - Intergenic
1011161332 6:84393569-84393591 AACCCACAGCAGCCAGGGCATGG + Intergenic
1013457307 6:110342277-110342299 TCCCAACAGCTCCCCAGGCATGG - Intronic
1015984039 6:138867955-138867977 TTGCCACAGCACCCCAGCCTGGG + Intronic
1018031570 6:159845515-159845537 TTTCCAGAGCAGCCCAGGCAGGG - Intergenic
1019406183 7:885465-885487 CTCCCAGAGCACCGCTGGCAGGG - Intronic
1019481857 7:1270578-1270600 TGCCCTCAGCACCCCTGGGAAGG + Intergenic
1019729415 7:2622207-2622229 TTCCCACAGCTCTCAGGGCAAGG - Intergenic
1021766701 7:23956956-23956978 ATTCCACAGCACCCAGGCCAGGG + Intergenic
1022407850 7:30108832-30108854 TTTCCACAGCACCCCAGGTGTGG + Intronic
1022480878 7:30742248-30742270 TTCCCCCAGCACCCCGCCTAGGG - Intronic
1026800237 7:73395847-73395869 TACCCTCAGCGCCCAGGGCATGG + Intergenic
1029284768 7:99457962-99457984 TGCCCACAGCACTCATGGCAAGG + Intronic
1033570137 7:142619348-142619370 TACCGACAGGACCCAGGGCAAGG + Intergenic
1034233546 7:149551136-149551158 TTCCCACATCAGCACAGGCAGGG - Intergenic
1034564775 7:151904390-151904412 TTCCCACAGGGCCCCGGGTCAGG - Intergenic
1035279277 7:157767057-157767079 TTGCCACAGCTCCCCCTGCAGGG + Intronic
1036380889 8:8235860-8235882 CTCCCACAGCACCACGGGTCTGG + Intergenic
1039542244 8:38382012-38382034 TTCCCGCAGCACGCCCGGCCCGG - Exonic
1041678713 8:60564288-60564310 TACCCACAGCACCAAGGGAAAGG - Intronic
1046084417 8:109415038-109415060 GTCCCACAGCACTCCAGCCACGG - Intronic
1049108660 8:140629355-140629377 TTCCCACCTGGCCCCGGGCACGG - Intronic
1049208959 8:141376559-141376581 ATCCAAAAGCACCCCGGCCATGG - Intergenic
1049303292 8:141883212-141883234 TTCCCAGAGCCCCCAGGGCAGGG - Intergenic
1049341171 8:142113418-142113440 TTCCCACATCACCCACGGGAAGG - Intergenic
1049383831 8:142331041-142331063 GCCCCACTGCAGCCCGGGCAGGG + Intronic
1049709966 8:144059050-144059072 TTCATACAGCACCTCAGGCATGG + Exonic
1050472368 9:6007381-6007403 TTCCCGCAGCAGCCCGGACAGGG - Exonic
1053423964 9:37998958-37998980 TTCCTCCAGCAGCCTGGGCAGGG - Intronic
1057576100 9:96244088-96244110 CTCCTCCAGCACCCAGGGCACGG + Intronic
1058471893 9:105288389-105288411 ATGCCACCGCACCCCGGCCAGGG - Intronic
1060481224 9:124017837-124017859 TTCCCGCAGCCCCTCGGGCCCGG + Intronic
1060608644 9:124940885-124940907 TCCCCACAGCGGCCCGGTCAGGG - Intronic
1061498741 9:130990380-130990402 ATCCCAGAGCACCCTGGGCCAGG + Intergenic
1061545432 9:131301645-131301667 CTCCCACAGCTTCCCGGGCCAGG + Intronic
1061754313 9:132802252-132802274 CTCCCACACCACACCGGGGAAGG - Intronic
1062430349 9:136524072-136524094 CTCCCCCCACACCCCGGGCACGG + Intronic
1189720126 X:43907285-43907307 TTCACCCAGCACCAGGGGCAAGG - Intergenic
1190444365 X:50508371-50508393 ATCCCACACCACCCCTGCCAGGG + Intergenic
1196090458 X:111735887-111735909 TTTCCACAGCACCCAGTACAGGG - Intronic
1196811767 X:119634661-119634683 TTCCCACAGCACAGCCGGAATGG - Intronic