ID: 1181490667

View in Genome Browser
Species Human (GRCh38)
Location 22:23258993-23259015
Sequence CAGGCGGAACAAAGGGAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 235}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181490654_1181490667 18 Left 1181490654 22:23258952-23258974 CCCACACACTTTCCTCTGACTGC 0: 1
1: 0
2: 4
3: 27
4: 249
Right 1181490667 22:23258993-23259015 CAGGCGGAACAAAGGGAGCACGG 0: 1
1: 0
2: 0
3: 23
4: 235
1181490651_1181490667 25 Left 1181490651 22:23258945-23258967 CCCCGCACCCACACACTTTCCTC 0: 1
1: 0
2: 3
3: 32
4: 421
Right 1181490667 22:23258993-23259015 CAGGCGGAACAAAGGGAGCACGG 0: 1
1: 0
2: 0
3: 23
4: 235
1181490649_1181490667 27 Left 1181490649 22:23258943-23258965 CCCCCCGCACCCACACACTTTCC No data
Right 1181490667 22:23258993-23259015 CAGGCGGAACAAAGGGAGCACGG 0: 1
1: 0
2: 0
3: 23
4: 235
1181490659_1181490667 6 Left 1181490659 22:23258964-23258986 CCTCTGACTGCAGGCAGGGCCAT No data
Right 1181490667 22:23258993-23259015 CAGGCGGAACAAAGGGAGCACGG 0: 1
1: 0
2: 0
3: 23
4: 235
1181490650_1181490667 26 Left 1181490650 22:23258944-23258966 CCCCCGCACCCACACACTTTCCT 0: 1
1: 0
2: 3
3: 66
4: 747
Right 1181490667 22:23258993-23259015 CAGGCGGAACAAAGGGAGCACGG 0: 1
1: 0
2: 0
3: 23
4: 235
1181490655_1181490667 17 Left 1181490655 22:23258953-23258975 CCACACACTTTCCTCTGACTGCA No data
Right 1181490667 22:23258993-23259015 CAGGCGGAACAAAGGGAGCACGG 0: 1
1: 0
2: 0
3: 23
4: 235
1181490653_1181490667 23 Left 1181490653 22:23258947-23258969 CCGCACCCACACACTTTCCTCTG 0: 1
1: 0
2: 4
3: 66
4: 636
Right 1181490667 22:23258993-23259015 CAGGCGGAACAAAGGGAGCACGG 0: 1
1: 0
2: 0
3: 23
4: 235
1181490652_1181490667 24 Left 1181490652 22:23258946-23258968 CCCGCACCCACACACTTTCCTCT 0: 1
1: 0
2: 2
3: 66
4: 564
Right 1181490667 22:23258993-23259015 CAGGCGGAACAAAGGGAGCACGG 0: 1
1: 0
2: 0
3: 23
4: 235
1181490648_1181490667 30 Left 1181490648 22:23258940-23258962 CCACCCCCCGCACCCACACACTT 0: 1
1: 0
2: 22
3: 208
4: 1838
Right 1181490667 22:23258993-23259015 CAGGCGGAACAAAGGGAGCACGG 0: 1
1: 0
2: 0
3: 23
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181490667 Original CRISPR CAGGCGGAACAAAGGGAGCA CGG Intronic
900439240 1:2645118-2645140 CAGGCCTCACACAGGGAGCAGGG + Intronic
900831222 1:4967131-4967153 CAGCTGGAGCAGAGGGAGCAGGG - Intergenic
901328092 1:8381243-8381265 CAGTCGGAGGAAAGGGAGGAGGG - Intronic
903567202 1:24276893-24276915 CGGGAGGAACAGAGCGAGCATGG + Intergenic
904395591 1:30219361-30219383 TGGCCGGAGCAAAGGGAGCAGGG + Intergenic
904674463 1:32190342-32190364 GAGGAGGAAGAAAGGGAGAATGG - Intronic
905016894 1:34783907-34783929 CAGGCCCAGCACAGGGAGCAGGG + Intronic
905284479 1:36870310-36870332 CAGCCAGGACTAAGGGAGCAGGG - Intronic
905507740 1:38493503-38493525 CAGGAGGAAGAAAGAGAGCAAGG - Intergenic
905765522 1:40596902-40596924 TTGGGGGAAAAAAGGGAGCAAGG - Intergenic
906608595 1:47187423-47187445 CAGGCCTAACAAAGGGAGAGGGG + Exonic
910705186 1:90122206-90122228 CAAGCTGAAGAAAAGGAGCAAGG - Intergenic
910750805 1:90628025-90628047 GAGGGGGAACATAGGGGGCAAGG + Intergenic
911630212 1:100174995-100175017 CAGGAGCAAAAGAGGGAGCAGGG - Intronic
913671002 1:121097461-121097483 CAGGCGGATGGAAGAGAGCAAGG + Intergenic
914022765 1:143884882-143884904 CAGGCGGATGGAAGAGAGCAAGG + Intergenic
914661252 1:149792826-149792848 CAGGCGGATGGAAGAGAGCAAGG + Intronic
915312761 1:155012531-155012553 CAGGAGGATTAAAGGGAGCAGGG + Intronic
915597583 1:156904349-156904371 CAGGGGGAGCAAAGGAAACAGGG + Intronic
916606021 1:166343156-166343178 CAGGGGGAGCAGGGGGAGCAGGG + Intergenic
917471374 1:175328742-175328764 GAGCTGGAACAGAGGGAGCAAGG + Intronic
918463359 1:184797703-184797725 CAGACAGAACAAAGGGAAAAGGG - Intronic
918807746 1:189071323-189071345 CAGGGGAAGCAAAGGGAGTAGGG + Intergenic
919535760 1:198785967-198785989 CAGCCAGAAGAAAGGGAGAAGGG + Intergenic
919931585 1:202224759-202224781 CAGGCGGAACATAGAGAGGGAGG - Intronic
920080574 1:203369836-203369858 CAGGAGGAAAAGAGGAAGCAGGG + Intergenic
920166457 1:204039674-204039696 CAGGAGGAAGAGAGAGAGCAGGG - Intergenic
920841926 1:209562373-209562395 AAGGAGGGAAAAAGGGAGCAAGG + Intergenic
922809598 1:228408261-228408283 CAGGCAGAAGAAAGGCTGCAGGG + Exonic
923861781 1:237898918-237898940 CAGGGGGAAGGAAGGGATCAGGG - Intergenic
1063367407 10:5499601-5499623 CAATCGGAACAAAGGGAGGAGGG + Intergenic
1064459580 10:15520981-15521003 CAGAGGCAACAAAGTGAGCATGG - Intronic
1064564160 10:16623173-16623195 CAGGTGGGAGAGAGGGAGCAAGG - Intronic
1065757071 10:28940593-28940615 CAGTGAGTACAAAGGGAGCAAGG + Intergenic
1065991080 10:31011151-31011173 CAGGCTGAGCAGAGAGAGCATGG + Intronic
1067153350 10:43753945-43753967 CTGGCGGAACACAGGGAGTGTGG + Intergenic
1067573529 10:47388964-47388986 CAGGCTGAAGGAAGTGAGCAAGG - Intergenic
1068092917 10:52454996-52455018 GAGGGGGCACAGAGGGAGCAAGG - Intergenic
1068114525 10:52722755-52722777 CAGGAGGAACAGAGGGAACAGGG + Intergenic
1068948662 10:62755351-62755373 AAGGAGGAAGAAAGGGAGGAGGG + Intergenic
1071431882 10:85612928-85612950 CAGGAGGAATATAGGGAGAAAGG + Intronic
1071777572 10:88806341-88806363 CAGGAGGAGCAAAATGAGCAGGG - Intronic
1072815784 10:98507739-98507761 AAGGAGGAACAAAGGGAGGAAGG - Intronic
1075006924 10:118837743-118837765 CAGGAGGAAGAAAGAGAGAAGGG + Intergenic
1076581882 10:131517357-131517379 CAGAGGCAACAAAGGCAGCAGGG - Intergenic
1076928512 10:133508972-133508994 CAGGAGGAAGAGAGGGAGAAAGG + Intergenic
1077020198 11:413900-413922 CAGGCAGAAGAGAGGGTGCAGGG - Intronic
1077390725 11:2299638-2299660 CAGGTGGAACAAGGGCACCATGG + Exonic
1077961418 11:7080033-7080055 CAGGGGGAACACAGAGAGTAAGG + Intergenic
1079472864 11:20796805-20796827 TAGGAGGAATACAGGGAGCAAGG + Intronic
1080784620 11:35463438-35463460 CCGGGGGAACAAAGGCAACATGG + Intronic
1081311437 11:41578818-41578840 CAGGCGGGACAAAGTGAGAAAGG - Intergenic
1083307729 11:61769783-61769805 CCTGGGGAACAAAGGGAGCTGGG + Intronic
1083555277 11:63621124-63621146 CAGGAGAAAGAAAGGGTGCAAGG + Intergenic
1083627951 11:64081589-64081611 CAGGCCAAAGACAGGGAGCAAGG + Intronic
1085163068 11:74366922-74366944 CAGGGAGAACAATGGAAGCAGGG + Intronic
1088993091 11:114971485-114971507 CAGACTGAACAAAAGGAGCCAGG - Intergenic
1089304140 11:117516308-117516330 CATTCAGAAAAAAGGGAGCAGGG - Intronic
1089733192 11:120532299-120532321 CAGCCGGATCAAAGGAAGCTGGG - Intronic
1090416750 11:126545690-126545712 CAGGGAGAAGGAAGGGAGCAGGG + Intronic
1092047454 12:5442157-5442179 CAGGGAGAACAAGGGAAGCAAGG + Intronic
1093224015 12:16459444-16459466 CAGGCTAACCAAAGGGAGAAAGG - Intronic
1093895722 12:24572396-24572418 CAGGCCCAACAAGGTGAGCAGGG - Intergenic
1095601343 12:44016422-44016444 CAGGTGGGACACAGGGAGAAAGG - Intronic
1098140350 12:67444479-67444501 CAGGTTGAACAAAAGGAGCTAGG + Intergenic
1099418892 12:82427741-82427763 CAGGCGAAACCCAGGGAACAAGG - Intronic
1101548656 12:105740963-105740985 CAGGCGGAAGAAAGGATGGAAGG + Intergenic
1103199162 12:119072429-119072451 AAGGATGAAGAAAGGGAGCAGGG + Intronic
1103546983 12:121709192-121709214 AAGACGGAAAAAAGGGAGAAAGG - Intergenic
1104569496 12:129912568-129912590 AAGACGGAACAAAGGAAGGAAGG + Intergenic
1105344231 13:19559569-19559591 GAGGAGGAGCAAAGGGAGCATGG + Intergenic
1105535800 13:21262005-21262027 GAGGAGGAGCAAAGGGAGCATGG - Intergenic
1108954967 13:56141773-56141795 AAGGTGGAGAAAAGGGAGCATGG - Intergenic
1110240628 13:73262501-73262523 CAGGAGGAAGAGAGAGAGCAAGG + Intergenic
1111317943 13:86585539-86585561 CAGGAGGAAGAGAGGGAGAAAGG - Intergenic
1111422371 13:88030029-88030051 CAGGCACAACAAAAGGAACATGG - Intergenic
1113062502 13:106338311-106338333 CAGGAGCAAGAAAGGGAGCAGGG - Intergenic
1114290671 14:21285868-21285890 CAGGCAGAAATAAGGGAGGATGG + Intergenic
1116651853 14:47603902-47603924 CAGGAGCAAGAAAGAGAGCAGGG - Intronic
1118139628 14:63066145-63066167 CAGCCAGAAAAAAAGGAGCATGG + Intronic
1118851022 14:69583642-69583664 CAGGCAGAAGAGAGGGAGCAGGG - Intergenic
1120516951 14:85482098-85482120 CAAGGGGAAGAAAGGGAGCAGGG + Intergenic
1120791655 14:88589747-88589769 CAGGTGGAACAAGGGAAGGAGGG - Intronic
1121288250 14:92753388-92753410 CAGGAGGAAGAGAGAGAGCAGGG - Intergenic
1122277873 14:100604473-100604495 CAGGAGGAGCAAAGGGCTCACGG + Intergenic
1122628673 14:103097562-103097584 CAGGCGGAACATCGGTATCAGGG - Intergenic
1123876994 15:24633424-24633446 CAGGGGGAACACAGAGAGTAAGG + Intergenic
1127834413 15:62778891-62778913 CATGCTGAGCAAAGGGAGAATGG - Intronic
1129259091 15:74353884-74353906 CAGGCCCAACAAAGGTAGCTTGG - Intronic
1129301339 15:74627338-74627360 CATGCAGAACTAAGGTAGCAGGG - Exonic
1131404115 15:92149750-92149772 CACTAGGAACAAAGTGAGCAAGG - Intronic
1131510093 15:93044998-93045020 CTAGCAGAACACAGGGAGCAGGG + Exonic
1133663004 16:7937130-7937152 CAGGAAGGACAAAGGGAGAAAGG + Intergenic
1139332661 16:66205557-66205579 GAGGGGGAACAAAGGGAGGGAGG + Intergenic
1139679895 16:68553374-68553396 AAGGCGGAACACAGGCACCAGGG + Intronic
1140018678 16:71215247-71215269 AAGGAGGAAGAAAGGGAGGAAGG + Intronic
1140771249 16:78205884-78205906 CAGGAGGAAGGAAGGGAGGATGG - Intronic
1140775838 16:78248275-78248297 CAGGAGCAAGAGAGGGAGCAAGG + Intronic
1143921153 17:10331998-10332020 CAGGTGGACCAAAAGGAGAAGGG + Intronic
1149013292 17:51880204-51880226 CAGGAGGAATAAAGGGAGGAGGG - Intronic
1150507542 17:65714990-65715012 CAGGTGGAGCAGAAGGAGCAAGG + Intronic
1151353782 17:73546554-73546576 CTGGCTGACCAGAGGGAGCAAGG + Intronic
1152259546 17:79259674-79259696 CAGGCTCAGCAAAGGGAGCCCGG - Intronic
1153535247 18:6095324-6095346 CAGGCTGAAGAAGGGGAACATGG + Intronic
1153819723 18:8823142-8823164 CAGGTGGAACGAAGAGAGTATGG - Intronic
1156001413 18:32388825-32388847 GAGGCGGAAAAAATGCAGCAAGG + Intronic
1157194338 18:45608478-45608500 CAGTTGGAACAAAAAGAGCATGG - Intronic
1158499028 18:57983427-57983449 CAGGCAGAAGCAGGGGAGCAAGG + Intergenic
1159237133 18:65691076-65691098 AAGGGGGAACAAAGAGAGAATGG + Intergenic
1159898604 18:74021053-74021075 CAGGAGGAAGAGAGAGAGCAAGG + Intergenic
1160893817 19:1393526-1393548 CAGAGGGATCAGAGGGAGCAGGG + Intronic
1162207375 19:9065843-9065865 CAGGCAGAACCAAGGGCCCAGGG - Intergenic
1162582793 19:11540703-11540725 CAGGGGGCACAGAGGGGGCAGGG + Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1164603240 19:29577752-29577774 TAGGCGGCACCAAGGGAGCTGGG - Intergenic
1165134906 19:33661654-33661676 CAGGGGGAGCCAAAGGAGCAAGG - Intronic
1166228535 19:41412050-41412072 AAAGCGGAACAAAGGCAGCCTGG - Intronic
1167197949 19:48043808-48043830 TGGGCGGGGCAAAGGGAGCAGGG - Intronic
1168610136 19:57792464-57792486 GAGGAAGAAGAAAGGGAGCAGGG + Intronic
925283587 2:2701701-2701723 AAGGCGGAAGAAAGGGAGACTGG - Intergenic
925351022 2:3200795-3200817 CAGGCAGAACAGTGGGGGCAGGG + Intronic
925693509 2:6549579-6549601 CAGGAGGAAGAGAGGGAGGAAGG - Intergenic
928756414 2:34531090-34531112 CAGCCTAAAGAAAGGGAGCATGG + Intergenic
929830022 2:45339619-45339641 CAAGCGGTACACAGGGAGCTTGG + Intergenic
930002232 2:46869222-46869244 CAGGAGGCACACAGGGAGCTTGG - Intergenic
932803400 2:74762559-74762581 CAGGAGGACTAAAGGCAGCAAGG - Intergenic
932834448 2:75023185-75023207 CAGGGGGAGTAGAGGGAGCAAGG + Intergenic
935720120 2:105972611-105972633 CAGGTGCAGCAAAGGGAGCCAGG - Intergenic
935736522 2:106110971-106110993 CAGGCAGGAGCAAGGGAGCAAGG + Intronic
935753670 2:106260866-106260888 CAGGTGGAAGAAGGGGAGAAGGG + Intergenic
936112570 2:109677072-109677094 CCAGCCAAACAAAGGGAGCAAGG - Intergenic
936856022 2:116958163-116958185 CAGGAGGAAGAGAGAGAGCAGGG + Intergenic
937071526 2:119067276-119067298 CAGGCAGCACAAAGGGCTCAGGG + Intergenic
937097492 2:119245246-119245268 CAGGAGGGACAAAGGGTGGAGGG + Intronic
937368932 2:121284771-121284793 CAGGCGGCAGAGAGGGTGCAGGG - Intronic
937445884 2:121957505-121957527 AAAGCGGCACAATGGGAGCAGGG + Intergenic
937984835 2:127633733-127633755 CTGGGGGAACAAAGGGGCCAGGG + Intronic
940647083 2:156402968-156402990 CTGGTGGAACTGAGGGAGCAGGG + Intergenic
942401643 2:175609453-175609475 CAGTAGGAACAAAGGAAGCTGGG - Intergenic
942697760 2:178665029-178665051 TTGGTGGAACAAAGGGAGGATGG - Intronic
943291648 2:186079547-186079569 CAGGAGGAAGAAAGAGAGAATGG + Intergenic
946012899 2:216580693-216580715 CAGGAGGAAGGAAGGGAGGAAGG - Intergenic
946309890 2:218877639-218877661 CAGGCGGAACACAGGCAGATGGG + Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947729695 2:232421027-232421049 CAGGAGGAAGGAAGGGAGCGCGG - Intergenic
947811077 2:233004309-233004331 CAGGTGGAAAGCAGGGAGCATGG - Intronic
947956999 2:234200903-234200925 CATGAGGAGCAAGGGGAGCAAGG + Intergenic
1170621160 20:17997455-17997477 ATGGCTGAACAAAGGGAGGAAGG - Intronic
1170647828 20:18212573-18212595 CAGGTGGAACAGAGAGAGAAAGG + Intergenic
1171265353 20:23767169-23767191 CAGGCAGGAGAAAGGGAGTAGGG + Intergenic
1171943967 20:31359286-31359308 AAGGCAGAACAAAGGGAAGAAGG + Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172775047 20:37402409-37402431 CAGGCGGAACCGTGGGAGCCTGG - Intronic
1174393292 20:50231398-50231420 CAGGCAGAACAGTGGGAGGAAGG + Intergenic
1175653455 20:60748936-60748958 CAGGCGGGACAGAGGGGGCATGG + Intergenic
1177769665 21:25500393-25500415 AAGGTGGAAAAAAGGGAACATGG + Intergenic
1179088497 21:38242000-38242022 CAGAGGGCAAAAAGGGAGCAAGG - Intronic
1179226070 21:39454565-39454587 CAGGGGGGACAAAGGGAGAGAGG + Intronic
1179444212 21:41420255-41420277 CAGGCAGGACAAAGCGGGCAAGG + Intergenic
1180783506 22:18534702-18534724 CGGCCTGAACAAAGGGAGGATGG - Intergenic
1180875742 22:19174529-19174551 TTGGGGGTACAAAGGGAGCACGG - Intergenic
1181127073 22:20708753-20708775 CGGCCTGAACAAAGGGAGGATGG - Intronic
1181240408 22:21474054-21474076 CGGCCTGAACAAAGGGAGGATGG - Intergenic
1181392418 22:22593432-22593454 TAGGGGGAACAGATGGAGCAGGG + Intergenic
1181490667 22:23258993-23259015 CAGGCGGAACAAAGGGAGCACGG + Intronic
1182266222 22:29117706-29117728 CATGAGGAACAAATGGAGAAAGG + Intronic
1182916571 22:34038349-34038371 CAGGAGGAAAAAAGGGAGAGAGG - Intergenic
1184144310 22:42599882-42599904 CTGGAGAAACAAAGGGACCAAGG + Intronic
1184242083 22:43216698-43216720 AAGGGGGGACAAAGGGAGCTTGG - Intronic
1184414491 22:44344353-44344375 CAGGAAGCACAAAGGAAGCAGGG - Intergenic
1185266776 22:49908170-49908192 CAGGCAGGACCAAGGCAGCAAGG + Intronic
951120457 3:18920831-18920853 GAGGTGGAAGAAAGGAAGCAAGG + Intergenic
953382855 3:42487110-42487132 CAGGCTGCAGGAAGGGAGCAGGG - Intergenic
953484907 3:43286364-43286386 CTGGCGGGACAAAGCGGGCAAGG - Intergenic
960942027 3:122941164-122941186 CAGGCAGAAGAAAAGGAGGAAGG + Intronic
961334366 3:126161449-126161471 CAGGAGTCACAAAAGGAGCAAGG + Intronic
961534369 3:127560661-127560683 CAAGGGGAACAAGGAGAGCAGGG - Intergenic
962580095 3:136790343-136790365 AAGGAGGAACCAAGAGAGCATGG + Intergenic
962705991 3:138045213-138045235 AAGGCAGAACAAAAGGAGCCTGG + Intergenic
962928166 3:140013972-140013994 AAGCCAGAACAAAGGGAACAAGG - Intronic
966170428 3:177074081-177074103 CATAAGGAATAAAGGGAGCAGGG + Intronic
967862687 3:194163923-194163945 CAGGAGGAGGAAAGGGAGGAGGG - Intergenic
969984301 4:11191147-11191169 CAGGAGGAAGAGAGAGAGCAGGG + Intergenic
970352401 4:15216040-15216062 CAGGAGCAAGAGAGGGAGCAGGG - Intergenic
975892843 4:79050027-79050049 CAGGCGGCACAGAGCGAGCACGG - Intergenic
976126079 4:81835053-81835075 AAGGAGGAACAGAGGGAGGAAGG + Intronic
977378189 4:96236317-96236339 CAGGAGGAAGACAGAGAGCAGGG - Intergenic
982789636 4:159576044-159576066 CAGGCTCAACTAAGGGATCAGGG + Intergenic
985099702 4:186446715-186446737 CAGGCGGAAGGAAGGAAGGAAGG - Intronic
985932455 5:3069169-3069191 CAGGCAGAACCAAGGGAGGGAGG - Intergenic
986360854 5:6976417-6976439 CAGGAGGAAGAGAGAGAGCAGGG - Intergenic
986970970 5:13336043-13336065 CAGGAGTAACACAAGGAGCAAGG + Intergenic
987320983 5:16769028-16769050 CACGGGGAACAAAGGGAGCGAGG + Intronic
989092754 5:37751061-37751083 CAGGGGGAAAAAAAGGAACAAGG - Intronic
989808315 5:45640003-45640025 CAGGCTGAACAAGTGGACCAGGG - Intronic
990136177 5:52646032-52646054 CAGGAGAAAGAAAGGGAGAAGGG - Intergenic
991206650 5:64057743-64057765 AAGGTGGAACAATGGGAGTAGGG - Intergenic
993130830 5:83896244-83896266 CAGAGGGAGCAGAGGGAGCAGGG + Intergenic
993560595 5:89402590-89402612 CAGGGGCAACAAAGGGAGACAGG + Intergenic
994073142 5:95622991-95623013 AAGGAGGAACAAAGAGAGGAAGG - Intergenic
995212831 5:109560219-109560241 CAGGCGCTACAAAGGGCTCATGG - Intergenic
998148316 5:139743100-139743122 CAGGAGGAGGAAAGGGACCAAGG - Intergenic
998731864 5:145087133-145087155 GAGGAGGAAGAAAGGGAGCAAGG - Intergenic
999652641 5:153782767-153782789 CAGGCGGAAGACGGGGAGGAAGG + Intronic
1000239119 5:159392872-159392894 CAGGAGGAAGAGAGAGAGCAGGG - Intergenic
1003002454 6:2348922-2348944 GAGGTTGAACAAAGGCAGCAGGG - Intergenic
1003977835 6:11360584-11360606 CAGGAGGAAGAGAGAGAGCAGGG - Intronic
1005022464 6:21431390-21431412 CAGGAGCAACAAAGAGAGTAGGG - Intergenic
1006932047 6:37694461-37694483 AAGGCGGCACATAGGGACCAGGG - Intronic
1008050774 6:46898487-46898509 AAGGAGGGAGAAAGGGAGCATGG + Intronic
1009825967 6:68866317-68866339 CAGGAGAAAGAAAGGGAGCAAGG - Intronic
1011651141 6:89507557-89507579 CAGACAGAACAAACAGAGCACGG + Intronic
1014048621 6:116925502-116925524 CAACCGTAATAAAGGGAGCATGG + Exonic
1014075429 6:117229667-117229689 CAGGAGGAAGACAGAGAGCAAGG + Intergenic
1014992728 6:128102624-128102646 CAGGTGGAAGAAAGTGTGCATGG + Intronic
1015219580 6:130788798-130788820 CAAGTGGAACAAGGGGAGAAAGG + Intergenic
1015729406 6:136333039-136333061 CATGGGGAACAAGAGGAGCAGGG + Intergenic
1019665046 7:2247623-2247645 CAGGCGGAACACGGGGAACAGGG - Intronic
1020391721 7:7665671-7665693 CAGAGGGAACAAAGGAAGGAGGG - Intronic
1021773086 7:24024757-24024779 CAGGCTGAACAGATGGAACACGG - Intergenic
1023738913 7:43260400-43260422 TAGGTGCAACACAGGGAGCAAGG + Intronic
1023830330 7:44035442-44035464 CAGAAGGGACTAAGGGAGCAAGG - Intergenic
1026354049 7:69541937-69541959 TAGGAGGAAGAGAGGGAGCAGGG + Intergenic
1027581746 7:80005425-80005447 CAGGAGGAAGAGAGAGAGCAGGG - Intergenic
1029177957 7:98678283-98678305 CAGAGGGAAGAAGGGGAGCAGGG + Intergenic
1029374317 7:100168665-100168687 CTGGCGGCACAAAGGGAGGAGGG - Exonic
1029740653 7:102489729-102489751 CAGAAGGGACTAAGGGAGCAAGG - Intronic
1029758647 7:102588901-102588923 CAGAAGGGACTAAGGGAGCAAGG - Intronic
1031485042 7:122315370-122315392 CAAGCGGAACAGAGAGAGAAAGG - Intergenic
1031846236 7:126808546-126808568 GAGGCTGAACAAAGGTAACAGGG - Intronic
1037806245 8:22059227-22059249 CAGGAGGAAGAAAGGGAGAGAGG + Exonic
1038497384 8:28013249-28013271 GAGGAGGAAGAGAGGGAGCAAGG + Intergenic
1038662560 8:29509816-29509838 CAGGAGGAAGAGAGGGAGCAGGG + Intergenic
1040006834 8:42628132-42628154 CAGGGGGAGCAGAGGGACCAGGG - Intergenic
1040435043 8:47381913-47381935 CTGGTAGAACAAAGGGAGGATGG - Intronic
1040452311 8:47560410-47560432 CAGGCGGGACGAAGGGAAAAGGG - Intronic
1040694598 8:49980421-49980443 CAGGCAGAAACTAGGGAGCAGGG - Intronic
1042007061 8:64192864-64192886 GAGGCAGAGAAAAGGGAGCAGGG - Intergenic
1046595346 8:116255045-116255067 CAGGGGGAAGAAAGGGAGAGAGG - Intergenic
1047158338 8:122347794-122347816 GAGAAGGAACAAAGTGAGCAAGG + Intergenic
1050290161 9:4145730-4145752 GAGGGGGAACAAAGGGAGGAGGG - Intronic
1050997416 9:12237925-12237947 CAGGCTGAAAAAACAGAGCATGG + Intergenic
1053020590 9:34691395-34691417 CAGGGGGAAGAAGGGGGGCAGGG - Intergenic
1056293087 9:85163650-85163672 CATGGGTAACAAAGGGAGCTTGG - Intergenic
1056757131 9:89388823-89388845 CTGGCGGCATCAAGGGAGCAAGG + Intronic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1059299002 9:113297927-113297949 CAGGCGGAGCAGGGCGAGCATGG + Exonic
1059451224 9:114372548-114372570 CAGGAGGAAGGAAGGGAGGAGGG + Intronic
1062592095 9:137278763-137278785 CAGGCGGAGCACAGCGCGCACGG - Exonic
1187836514 X:23437134-23437156 AAGGCTGAACAAAGGTAGCAGGG - Intergenic
1188309247 X:28597064-28597086 AAGGAGGACCAAATGGAGCATGG + Intronic
1189253530 X:39619954-39619976 CAGAGGGAACAAGGGGAGTAGGG + Intergenic
1190048618 X:47132567-47132589 GAGGAGGAAGAAAGGGAGGAAGG - Intergenic
1191015249 X:55802725-55802747 CAGGAGGAATAAAGAGAGCGGGG - Intergenic
1195591645 X:106635073-106635095 CAGGCCCAAGAAGGGGAGCATGG + Intronic
1196401057 X:115317277-115317299 AAGGCGGGACAAAGTGAGCAGGG + Intergenic
1198368415 X:135967052-135967074 AGGGGGGAAGAAAGGGAGCAAGG + Intronic
1199720562 X:150540282-150540304 CAGGAGCAACAGAGAGAGCAGGG - Intergenic
1201586719 Y:15569208-15569230 CAGGCTGAACAAATGGGGGAAGG + Intergenic