ID: 1181491352

View in Genome Browser
Species Human (GRCh38)
Location 22:23262643-23262665
Sequence CAGCTGCTCTTGGGCAGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 331}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181491345_1181491352 -5 Left 1181491345 22:23262625-23262647 CCGCGTCGGGCTGCCCCGCAGCT No data
Right 1181491352 22:23262643-23262665 CAGCTGCTCTTGGGCAGCCAGGG 0: 1
1: 0
2: 2
3: 44
4: 331
1181491338_1181491352 26 Left 1181491338 22:23262594-23262616 CCTAGTGGAGGGTGGTGGCTCGG 0: 1
1: 0
2: 2
3: 28
4: 415
Right 1181491352 22:23262643-23262665 CAGCTGCTCTTGGGCAGCCAGGG 0: 1
1: 0
2: 2
3: 44
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181491352 Original CRISPR CAGCTGCTCTTGGGCAGCCA GGG Intronic
900462452 1:2808202-2808224 CGGCTGCTTTTGTGCTGCCACGG - Intergenic
900518441 1:3094298-3094320 AAGCACCCCTTGGGCAGCCACGG + Intronic
901860084 1:12068708-12068730 CAGCTGTTCTGGGTCAGGCATGG + Intronic
901972664 1:12920154-12920176 CAGGTTCTCAAGGGCAGCCATGG - Exonic
902012516 1:13281608-13281630 CAGGTTCTCAAGGGCAGCCATGG + Exonic
902124921 1:14201439-14201461 CAGCTGCTCCGGGGCAGCCAGGG - Intergenic
903185971 1:21629253-21629275 CAGCCGCCACTGGGCAGCCACGG - Intronic
904374331 1:30070447-30070469 GAGCTGCTCTGGGACAGCAAGGG - Intergenic
904912211 1:33943696-33943718 CAGCTCCTGTTTGGAAGCCAGGG - Intronic
906157400 1:43621823-43621845 CACCTGCTCTTGGCCAGCAGAGG + Intronic
907442166 1:54485837-54485859 CAGAGGCTCGGGGGCAGCCACGG - Intergenic
907603687 1:55794485-55794507 AACCTGTTCATGGGCAGCCATGG + Intergenic
909116326 1:71541763-71541785 CAGCTGCTCTTTGGCAGGCCTGG - Intronic
911530394 1:99036903-99036925 CAGCTGCTCTGCTCCAGCCATGG - Intergenic
912024927 1:105158105-105158127 CAGCTGCTATTGTGCTGCCCTGG - Intergenic
912491437 1:110064846-110064868 CAGCTGCCCTTGGACTGCCGAGG - Exonic
912852945 1:113142783-113142805 CCGCTGCTCTGGGACATCCAAGG + Intergenic
913501924 1:119479549-119479571 GATCTGCTCTTGAGGAGCCAGGG - Intergenic
915113652 1:153581626-153581648 CAGCTGTTCTTGGGAAGGGACGG + Intergenic
915347390 1:155204610-155204632 CAGTATCTCTTGGTCAGCCAAGG + Intronic
915551807 1:156639722-156639744 CAGCTGCTGTTGCGCAGACGAGG - Intergenic
916209716 1:162350427-162350449 CAGCTGCCCTTGGCCATCCCTGG + Intronic
917632191 1:176901454-176901476 CAGCTGCTCTTTGGTACCCGTGG - Intronic
918799424 1:188953521-188953543 CAGCTTCTCTTGCCCAGCCTAGG + Intergenic
922913802 1:229239383-229239405 CAGCTGCTCTTCACCAGCAAGGG + Intergenic
923425255 1:233862354-233862376 TAGCTGCTCTTGGGGGGCCTAGG + Intergenic
1063133339 10:3196737-3196759 CAGCTGCCCTTTTCCAGCCAAGG - Intergenic
1064012202 10:11743602-11743624 CAGCTGCTCTTGGCCACCTTTGG + Intronic
1064132835 10:12725201-12725223 CAGGGGCTCTTTGTCAGCCATGG + Intronic
1065427347 10:25619393-25619415 CAGCTGCTCTTGGCTAGGGAAGG - Intergenic
1065830203 10:29608356-29608378 CAGCTGCAGTGGGGAAGCCATGG + Intronic
1067224594 10:44367424-44367446 CAGCTGATGCTGGGCAGGCAGGG + Intergenic
1069726569 10:70583815-70583837 CAGCTACTCGTGTGCAGCCTGGG - Intergenic
1070552733 10:77503619-77503641 CAGCTGTCCTTGTGCAGTCATGG + Intronic
1071286083 10:84146944-84146966 ATCTTGCTCTTGGGCAGCCAGGG + Intronic
1071392471 10:85189715-85189737 CAGCTGCTTCTTGGCAGCAAAGG + Intergenic
1071794523 10:88990774-88990796 CAGCTCCGCCTGGGCAGCCAGGG - Exonic
1073196419 10:101695092-101695114 CGGCCGCTCATGGGCAGCCAGGG - Exonic
1073196975 10:101699512-101699534 CAGCTGCTCTGGGGCTGAAATGG - Intergenic
1073370965 10:102988606-102988628 CAGCTGCCCTAGAGCATCCAGGG + Intronic
1073621260 10:105051279-105051301 CAGCTGCTATTAGGCTGACACGG - Intronic
1074363358 10:112839658-112839680 CTGCTGCTGGTGGGCAGCCCAGG + Intergenic
1076300444 10:129421599-129421621 CAGCTTCTCTTGGGCAGCCCAGG - Intergenic
1076337348 10:129716699-129716721 CAGCTGCTCTTGAACATCAAAGG - Intronic
1076568249 10:131413352-131413374 CAACTGCTCTGGGACAGCCTAGG - Intergenic
1076807768 10:132867724-132867746 CAGCTGCTGTTTGACAGCCAGGG + Intronic
1076814662 10:132908867-132908889 GAGCCGCTCAGGGGCAGCCAAGG - Intronic
1077017656 11:404063-404085 CAGCAGGTCTCGGGCAGCGATGG - Exonic
1077416516 11:2426618-2426640 GAGCTGGTCTTGGGGAGCCCAGG - Intergenic
1077434220 11:2531023-2531045 CAGGTGCTCCTGCCCAGCCAGGG + Intronic
1077457018 11:2687444-2687466 CAGCAGCTCTTGTGCAGGCAGGG - Intronic
1077931726 11:6739879-6739901 CACCTGCTCTGGGGCATACAAGG - Intergenic
1079391372 11:20024719-20024741 CAGTTGCCCCAGGGCAGCCAAGG - Intronic
1080853014 11:36087825-36087847 CAGCTACTCTTGGGCAGCTGAGG - Intronic
1082315028 11:50707459-50707481 GAGCTCCTTTTGGGCAGGCATGG + Intergenic
1082825568 11:57575503-57575525 CAACAGCTCTTGGGAGGCCAAGG + Intergenic
1083584588 11:63847506-63847528 AAGCTGGTTTTGGGCAGCCTTGG + Intronic
1084337500 11:68468631-68468653 CAGCTGCTCTGCGGAAGTCAGGG + Intronic
1084554795 11:69869213-69869235 TGGTTGCTCTTGGGCAGGCAGGG + Intergenic
1084650185 11:70485024-70485046 GAGCTTCTCTTTGGAAGCCAAGG + Intronic
1084782126 11:71417069-71417091 TAGCTGCTCTTGGGCTACTACGG + Intergenic
1085446131 11:76602464-76602486 CAGCAGATGTCGGGCAGCCAGGG + Intergenic
1086212814 11:84341466-84341488 CAGATTCTCATGTGCAGCCAAGG - Intronic
1086661603 11:89426463-89426485 CAGCTTCCCTTGGCTAGCCAAGG - Intronic
1088093914 11:106076941-106076963 CAGCTGCTCGCTGGCAGCCTCGG + Intronic
1089127782 11:116189527-116189549 CAGCCCCTCCTGGGCAGCGAGGG + Intergenic
1089334951 11:117716841-117716863 CAGCTGCTTGTGCGCTGCCACGG + Intronic
1089340326 11:117752947-117752969 CAGCTCCCCTGGGACAGCCATGG - Intronic
1089541836 11:119193836-119193858 CAGCTGGTCTTCGGAAGCCTTGG + Exonic
1089580224 11:119476967-119476989 CAGCTGGACCTGGACAGCCAGGG + Intergenic
1089748917 11:120636549-120636571 CTGCTACTCTTGGCCAGGCACGG + Intronic
1091131111 11:133147987-133148009 CATCTGATGTTGGGAAGCCATGG + Intronic
1091596221 12:1880881-1880903 GAGCTGCTCTCTGGGAGCCAGGG - Intronic
1091694473 12:2618521-2618543 CCGGTGCCCTGGGGCAGCCAGGG + Intronic
1092447946 12:8575066-8575088 CAGCTGCTCAGGTGCAGGCATGG + Intergenic
1092680002 12:10968668-10968690 CAGCTGCTTTAGGGCTGGCAGGG + Intronic
1092947643 12:13471835-13471857 CATCTGCACTTGGGCAGCTTTGG + Intergenic
1094064222 12:26346330-26346352 CAGCTGCGCTGGGCCAGGCACGG + Intronic
1094207871 12:27859723-27859745 GAGCAGCCCTTGGGCAGGCAGGG + Intergenic
1095444961 12:42273955-42273977 CTGCTGGTCCTGGGCAGCAAGGG - Intronic
1095865195 12:46964201-46964223 GAGTTGCTCTTTGGCAGTCAAGG - Intergenic
1096355647 12:50938470-50938492 CAGCTGCAGCTGGCCAGCCACGG - Intergenic
1096524765 12:52203876-52203898 CAGCTGACCTTGGGGAGCGAGGG + Intergenic
1096552505 12:52382405-52382427 CATCTTCTCTAGGGCACCCAAGG - Intronic
1103496883 12:121369732-121369754 CAGTTGGTCTGGGGCAGCCTGGG + Intronic
1103561783 12:121796647-121796669 CGAGTGCTCATGGGCAGCCAAGG - Intronic
1103951452 12:124553842-124553864 GAGCTGCTGTGGGGCACCCACGG + Intronic
1104026748 12:125033024-125033046 CAGCTGCTCTGGGGCTGCAGCGG - Intergenic
1104141101 12:125986210-125986232 CACCTGCTCTGGACCAGCCACGG - Intergenic
1104401382 12:128479422-128479444 CAGCTGCTTTCGCACAGCCAGGG + Intronic
1106475423 13:30094225-30094247 CAGGTGCTCTGGGGTAGCCATGG + Intergenic
1106570680 13:30924604-30924626 CAGCTGCCCTGGGCCTGCCAGGG - Exonic
1108323990 13:49312327-49312349 CAGTTGCTCTGGGGGAGTCAGGG - Intronic
1111002572 13:82205167-82205189 CAGCTGTGCTTGGGAAGGCAGGG - Intergenic
1111253694 13:85639160-85639182 CAGCTGCTCCTGGGAGGGCAGGG + Intergenic
1111922205 13:94424250-94424272 CAGCTGATCTTGGGTAAGCAAGG - Intergenic
1112696084 13:101949825-101949847 CAGCTGCTCTAAGCCAACCATGG + Intronic
1113591498 13:111504518-111504540 CAGGTGCTCTTGGCAAGTCAGGG - Intergenic
1113792463 13:113036392-113036414 CAGATGTGCTTGGGCAACCAAGG + Intronic
1114667947 14:24391712-24391734 CTGGTGTCCTTGGGCAGCCAAGG + Intergenic
1114674590 14:24431809-24431831 CAGCTCCTCCTGGACAGCCAGGG - Exonic
1116950061 14:50871411-50871433 GAGCTACTCTAGGGAAGCCACGG - Intronic
1117030898 14:51668957-51668979 AAGCTGATTTTGGGCAGGCATGG - Intronic
1118458355 14:65965447-65965469 CAGCTGCTCCAAGGCAGCCCTGG + Intronic
1121145626 14:91579636-91579658 CAGTTGCTCTTTGCCAGCGAGGG - Intergenic
1121789795 14:96690433-96690455 CAGCTCCTCTGGGGCAGAGAGGG - Intergenic
1121996606 14:98607797-98607819 CAGCTTGTCTTGCCCAGCCATGG - Intergenic
1122009283 14:98732454-98732476 CAGCCACTCTTGGCCACCCATGG + Intergenic
1122365402 14:101192218-101192240 CAGGGTCCCTTGGGCAGCCATGG - Intergenic
1122588355 14:102826807-102826829 CAGCTGTCCTTTGGCAGCCCTGG - Intronic
1122835135 14:104427105-104427127 CCTCTGCTCCTGGGAAGCCATGG + Intergenic
1125330690 15:38579347-38579369 CATCTGATCTTGGGAAGTCAAGG + Intergenic
1125886859 15:43235754-43235776 CTGCTCCTCTTTGGGAGCCATGG + Exonic
1127632829 15:60842298-60842320 CTGCAGCCCATGGGCAGCCAAGG - Intronic
1128074867 15:64819812-64819834 CAGCTGGTCTTGCCCAGCCCAGG + Intronic
1128544203 15:68556317-68556339 CAGCTGTTCTTTGGAAGCCTGGG - Intergenic
1128737541 15:70061729-70061751 CAGCTGCCCTGGGTCAGCCCTGG + Intronic
1131872584 15:96777299-96777321 TAGCTGCCCGTTGGCAGCCAGGG - Intergenic
1132898206 16:2238753-2238775 CAGCTCCTTAGGGGCAGCCATGG + Intergenic
1135165738 16:20137729-20137751 TAGAGGCTCGTGGGCAGCCAAGG + Intergenic
1135631995 16:24043126-24043148 CAGCTGCTGTTGAGGATCCAAGG + Intronic
1135875262 16:26193326-26193348 CAGCTGCACTTGGCCAGTCAGGG - Intergenic
1136115413 16:28091413-28091435 CAGCTGCTCTGGGGACACCAAGG - Intergenic
1137267940 16:46884260-46884282 CAGCCGCTCCGGAGCAGCCAGGG + Intergenic
1137588491 16:49679235-49679257 CAGCTGCAGTTGGGGAGGCATGG + Intronic
1139329825 16:66178621-66178643 CAGATGCCCTTGGCCAGCCCTGG - Intergenic
1140220230 16:73038343-73038365 CAGCTGCAGCTGTGCAGCCAAGG + Intronic
1140412136 16:74747663-74747685 CAGCTGCTCTTGACCATCCTTGG - Intronic
1140670117 16:77269642-77269664 CTGCTGCTACTGGCCAGCCAGGG + Intronic
1141623541 16:85249648-85249670 CAGCTGCTCTGGGGCAGGCCTGG + Intergenic
1141720792 16:85754223-85754245 CAGCTGCTAGTGGGGACCCATGG + Intergenic
1142408779 16:89905680-89905702 CAGCGCCTCTTGGGCACCCCCGG - Intronic
1143806435 17:9431583-9431605 CTGCTGCCCTTGGCCAGCCGCGG - Intronic
1144584823 17:16481851-16481873 CAGGTGCTCCTGGGGAGGCAGGG - Intronic
1144837511 17:18164440-18164462 TAGCTGGACTTGGGCAGGCAGGG - Intronic
1145250243 17:21293455-21293477 CAGCTGCACAGGGGCAACCATGG - Intronic
1145250694 17:21295495-21295517 CGGCTGCACCTGGGCAGCCCTGG + Intronic
1145894915 17:28450348-28450370 AAGCAGATGTTGGGCAGCCAAGG + Intergenic
1146512199 17:33459745-33459767 CTGCTGCTCCTGGGCTGGCAGGG - Intronic
1146808743 17:35886684-35886706 CAGTTACTCTTGGTCAACCATGG + Intergenic
1146844828 17:36175932-36175954 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1146857133 17:36263867-36263889 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1146863482 17:36324508-36324530 CTGCTGCCCTTGGGCAGCTGTGG + Intronic
1146873045 17:36387777-36387799 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1146880403 17:36438863-36438885 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1147066342 17:37925096-37925118 CTGCTGCCCTTGGGCAGCTGTGG + Intronic
1147075928 17:37988402-37988424 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1147077875 17:38004657-38004679 CTGCTGCCCTTGGGCAGCTGTGG + Intronic
1147087453 17:38067948-38067970 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1147093811 17:38128592-38128614 CTGCTGCCCTTGGGCAGCTGTGG + Intergenic
1147103397 17:38191911-38191933 CTGCTGCCCTTGGGCAGCTGTGG - Intergenic
1148776057 17:50096263-50096285 TAGCAGCCCTGGGGCAGCCAAGG - Intronic
1149847971 17:60018380-60018402 CTGCTGCCCTTGGGCAGCTGTGG - Intergenic
1150086326 17:62274997-62275019 CTGCTGCCCTTGGGCAGCCGTGG - Intronic
1150157269 17:62864659-62864681 CATTTGCACTTGGGCAGCCTTGG + Intergenic
1150557267 17:66265764-66265786 GAACTACTCTTGGGCAGTCAGGG - Intergenic
1150653718 17:67025873-67025895 CAGCCGCCATTGGGGAGCCAAGG + Intronic
1150842801 17:68624890-68624912 TAGGTGACCTTGGGCAGCCATGG - Intergenic
1151611005 17:75175094-75175116 CAGCTACTCTTGGGAGGCTAAGG - Intergenic
1151751861 17:76043673-76043695 CTGCAGCTCCTGGGCAGTCAGGG + Intronic
1152039103 17:77891799-77891821 GAGTGGCTCCTGGGCAGCCATGG + Intergenic
1152140786 17:78535175-78535197 AGGCTGCTCTTGGGCACCCACGG - Intronic
1152379620 17:79935521-79935543 AGGCTGCCCTTGGGCTGCCACGG + Exonic
1152626768 17:81391272-81391294 CTGCTGCTCTTGGGGAGCGTGGG + Intergenic
1152723313 17:81933343-81933365 CACCTGCTCCTGGTCAGCCATGG + Exonic
1153179608 18:2418151-2418173 CAGCAGATCTGGGGCTGCCAAGG - Intergenic
1154334574 18:13455449-13455471 GAGATGCCCTTGGGTAGCCATGG + Intronic
1155035712 18:22023205-22023227 GAGCAGCTCTTGGGCTTCCAAGG + Intergenic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1157106838 18:44781771-44781793 CAGCTTCTCAAGGGCAGACATGG - Intronic
1157289007 18:46396918-46396940 CAGCTGTGCCTGGGCAGCCTGGG + Intronic
1157374984 18:47154238-47154260 CAACTGCTCTGGGGAAACCAGGG + Intronic
1158534512 18:58295769-58295791 CAGCTGCACTTTGGCACCCAGGG + Intronic
1160523990 18:79524796-79524818 CAGGTGCTCGTGGGCAGCAAGGG + Intronic
1160906245 19:1453012-1453034 CAGCTGCTCGTAGGGCGCCACGG - Exonic
1160969618 19:1761750-1761772 CACCTGACCTTGGGCAGCCTTGG + Intronic
1161201801 19:3019335-3019357 CAGCTGAGCCTGGGCAGCCAGGG + Exonic
1161303843 19:3556411-3556433 CAGCAGCTCTGAGGCAGACAGGG + Intronic
1161575416 19:5051998-5052020 CAGTTGCTCTTGGCCATCCTGGG + Intronic
1163027408 19:14520284-14520306 CAGCTGCCCCTGGGCAGACAGGG + Intronic
1163127577 19:15252584-15252606 CAGCCCTTCCTGGGCAGCCATGG + Intronic
1163251412 19:16128329-16128351 CACGGGCTCTTGGGCAGCCCTGG + Intronic
1163690969 19:18738231-18738253 CACCTGATCCTGGGAAGCCAAGG + Intronic
1167239265 19:48333647-48333669 CAGGGGCTCTTGGGCAGGGAAGG + Intronic
1167571364 19:50290939-50290961 CAGCTTCTTGCGGGCAGCCACGG - Exonic
925197383 2:1937241-1937263 CAGCTGCTCTGGGCAAGGCATGG - Intronic
925467842 2:4125618-4125640 CAGCAGCTCTAGGGGAACCAAGG - Intergenic
927718404 2:25367514-25367536 CAGCTGCTCCAGGGCGGCCATGG - Intergenic
928951165 2:36814210-36814232 TAGCTCCTCTTGGGCAGCCCAGG - Exonic
929581995 2:43087133-43087155 AAGCTGCTCTAGGGCAGACTTGG + Intergenic
930017605 2:46981699-46981721 CAGGTGCTCTGGGACTGCCAGGG + Intronic
930638088 2:53827977-53827999 TGGCAGCTCCTGGGCAGCCAGGG + Intergenic
931458869 2:62433211-62433233 CCGTTGCTCTTGGGGAGCCCTGG + Intergenic
932336066 2:70932065-70932087 CAGGTTCTCATGGGCAGCCAGGG + Intronic
933791199 2:85885312-85885334 CAGAGGCTCTTGGGGAGCTAAGG + Intronic
934893201 2:98088398-98088420 CAGATGCTCCTGGGCTGCCCTGG - Intronic
938289480 2:130141814-130141836 GGGCTGCTGCTGGGCAGCCAGGG + Intronic
938369887 2:130762383-130762405 CAGCTGCCCTGTGGCAGCCGTGG - Exonic
938467049 2:131531124-131531146 GGGCTGCTGCTGGGCAGCCAGGG - Intronic
939079871 2:137647050-137647072 CAGCAGCTGTTGGGCATCAAGGG - Intronic
941066894 2:160913535-160913557 CAGCTGCTCTGGTTCAGACAAGG - Intergenic
941585128 2:167349129-167349151 CAGTTACTCATGGGCAACCATGG + Intergenic
942050714 2:172138022-172138044 CATCTGCTTTTGGGCTGCCATGG + Intergenic
943267680 2:185756097-185756119 CAGCTCCTCTTGGGCATAAAAGG + Intronic
944581833 2:201138331-201138353 CAGCTGCTCATGGGAATCCTTGG + Intronic
945160380 2:206884317-206884339 CAGCTACTCTTGGGAGGCTAAGG + Intergenic
946400796 2:219467462-219467484 CTCCAGCTCTTGGGCACCCACGG - Intronic
947828776 2:233124597-233124619 CAGCTGTTCAGGTGCAGCCAGGG - Intronic
948351742 2:237346502-237346524 CAGCTGGTCCTGGGTAGCCAGGG + Exonic
948648899 2:239426609-239426631 CAGCCCCTCCTGGACAGCCAGGG - Intergenic
1168972047 20:1937735-1937757 CAGCACTTCCTGGGCAGCCACGG + Exonic
1169217221 20:3800838-3800860 CAGCAGCTCTGGGGAAGACAAGG + Exonic
1171865044 20:30482775-30482797 GAGCTCCTCTTGGGTTGCCAAGG - Intergenic
1171955174 20:31456344-31456366 AAGCTACTCTTGGCCAGGCACGG + Intergenic
1172094229 20:32452836-32452858 GGGCCGCTCCTGGGCAGCCAGGG - Intronic
1172135637 20:32684874-32684896 CAAATGCTGTTGTGCAGCCAGGG + Intergenic
1172793433 20:37521518-37521540 CAGCGGCACTTGGGCAGGCAAGG - Intronic
1173395788 20:42678125-42678147 CAGCAGCTCTGGGGGAGCAATGG + Exonic
1173525762 20:43731363-43731385 TAGCTCCTCTTGGGTTGCCATGG - Intergenic
1173729230 20:45317054-45317076 CAGCTGCCCTTCTGCAGCAAAGG - Exonic
1174831790 20:53820228-53820250 CAGGTGCTGTTCGGGAGCCAGGG + Intergenic
1175936930 20:62518251-62518273 CAGCTGTACTTGGGGAGCCATGG + Intergenic
1175988554 20:62776453-62776475 CACCTGTCCCTGGGCAGCCACGG + Intergenic
1176266712 20:64213102-64213124 TAGCTGCTCTGGGGCAGCCCAGG - Intronic
1177404228 21:20645400-20645422 CAGCTGCAGCTGGGCAGCTATGG - Intergenic
1177875509 21:26626417-26626439 CAGCTGCAATTGCCCAGCCATGG - Intergenic
1178181389 21:30166098-30166120 CAGCAGCGCTTGCCCAGCCAAGG + Exonic
1178931166 21:36820348-36820370 CAGCTGCTGCTGCCCAGCCACGG + Intronic
1179264257 21:39788697-39788719 CAGCTACTTCTGGGCAGCCTGGG - Intronic
1179822959 21:43947403-43947425 AAGCTCCGCTTGGGCAGCCCTGG - Intronic
1179907978 21:44434032-44434054 CAGCTGTCCTGGGGCAGCCACGG + Intronic
1179908718 21:44437024-44437046 CAGCGGGTCCTGGGCAGCCATGG + Intronic
1180009955 21:45042952-45042974 AGGCTGCCCTTGGGCAGCCTCGG - Intergenic
1180056693 21:45362562-45362584 CAGCTGCTCGATGGCAGCCGGGG + Intergenic
1181029933 22:20144787-20144809 CAGCTGCTGTTGGTCAGCGCTGG + Intronic
1181040925 22:20192317-20192339 CAGGTGTTCCTGGGCTGCCATGG + Intergenic
1181491352 22:23262643-23262665 CAGCTGCTCTTGGGCAGCCAGGG + Intronic
1181718069 22:24749767-24749789 CAGCCACTTTTGGTCAGCCAGGG - Exonic
1181718125 22:24750292-24750314 CAGCCACTTTTGGCCAGCCAGGG - Intronic
1182828287 22:33284226-33284248 CACCTGCTCTGGTGCGGCCAGGG - Intronic
1183031522 22:35110064-35110086 TAGATGTTCTTGGGCAGCCAGGG + Intergenic
1183059561 22:35327832-35327854 CCACTGATCTTGGGGAGCCAAGG + Intronic
1183060922 22:35335941-35335963 CAGCTGCTGTGCGGGAGCCAGGG - Intronic
1183252235 22:36738212-36738234 CAGAGGCTCTTGGACAGCCAAGG + Intergenic
1183582568 22:38734666-38734688 CAGCTGCTCTTGGGCAGATGAGG - Intronic
1184043717 22:41959062-41959084 CTGCAGCTCTTGGGAAGCCCTGG - Intergenic
1184423496 22:44395484-44395506 CAGCTGCTGTTGGGCATCGTAGG + Intergenic
1185003352 22:48260170-48260192 CTGCTGTTCAGGGGCAGCCATGG + Intergenic
1185409034 22:50673203-50673225 GAGCTGCTCTTGGGGAGGCTGGG + Intergenic
949467047 3:4354735-4354757 CAGATGGTCCTGGGCAGCCATGG - Intronic
951560568 3:23962118-23962140 CAGCTGTTCCTGGGCTGGCAAGG - Exonic
954109079 3:48424295-48424317 CAGCTGCTCCTGGTGAGCCCAGG - Exonic
954376015 3:50194468-50194490 CAGCAGCTGTTGGGCACCCGGGG - Intronic
954973489 3:54671644-54671666 CAGCTGCTCCAGGGCAGGAATGG + Intronic
955432164 3:58857629-58857651 TAGCAGTTCTAGGGCAGCCAAGG - Intronic
956881033 3:73510930-73510952 CAGCTGCTTGTGGTCAACCATGG - Intronic
956972405 3:74541980-74542002 CACCAGCACTTGGGAAGCCAAGG + Intergenic
961044257 3:123698117-123698139 CAGCTGTTCTTGGGCTTGCATGG - Intronic
961793817 3:129395199-129395221 CTGCTGTTCTTGTGCAGGCATGG + Intergenic
962744452 3:138387261-138387283 CACCTGCGCCTGGGCAGCCATGG - Intronic
962807369 3:138937132-138937154 CAGTTGCGCGTGGTCAGCCATGG + Intergenic
963624296 3:147651287-147651309 GAGCTGATCTTGGGCAGCTTAGG + Intergenic
964418139 3:156471607-156471629 CAGCTGCCCTTCTGGAGCCAAGG + Intronic
967818114 3:193815921-193815943 CACCTGGCCTTGGGCAGACAAGG - Intergenic
967936063 3:194728723-194728745 CAGCTACTGTTGGGAAGCCAAGG - Intergenic
967979405 3:195056637-195056659 TAGCAGCTCTTCGGCAGGCAAGG + Intergenic
968595485 4:1480137-1480159 CAGCAGCAATGGGGCAGCCATGG + Intergenic
968731792 4:2272649-2272671 CAGCAGCTCATGGGCAGCAGTGG + Intronic
969054766 4:4394659-4394681 CAGCCGCTCTATGCCAGCCATGG + Intronic
969202720 4:5618478-5618500 CTGCAGCTCAGGGGCAGCCACGG + Exonic
969239254 4:5888403-5888425 CAGCCGCGCGTGGGCATCCACGG - Intronic
969443087 4:7228740-7228762 CAGCTGCTCTGGGGCTGCTGTGG + Intronic
969548832 4:7850694-7850716 CTGCTGGTGTGGGGCAGCCATGG + Intronic
971141716 4:23931796-23931818 CAGTAGCTCATGGGAAGCCATGG + Intergenic
973189320 4:47368815-47368837 AAGTTGCTCTTGGCCAGGCATGG + Intronic
976337790 4:83910894-83910916 CAGCTGTTCTTGTGCATACAGGG + Intergenic
980469618 4:133234246-133234268 CAGCTGATCTTGGGCCCTCAGGG + Intergenic
981058472 4:140392664-140392686 CAGCTGCTGAAGGGCACCCATGG - Exonic
981411934 4:144442364-144442386 GGGCAGCTTTTGGGCAGCCATGG + Intergenic
982096873 4:151931337-151931359 CAGTAGTTCTGGGGCAGCCATGG + Intergenic
983605054 4:169573908-169573930 CAGCACTTTTTGGGCAGCCAAGG + Intronic
985267422 4:188162992-188163014 GAGCTGCTGCTGGGCAGCCTCGG + Intergenic
985536837 5:469681-469703 CTGCGGCCCATGGGCAGCCATGG - Intronic
985674706 5:1224956-1224978 CAGCTGCTCTTGGGAGGCCGGGG - Exonic
985782942 5:1880529-1880551 CACCTGCTCCTGCACAGCCATGG - Intronic
988158452 5:27486612-27486634 CAGCTGGGCTTGGGAAGCCAGGG - Intergenic
992865708 5:80955220-80955242 CAGCTGTTCGTGGCCACCCATGG + Intergenic
994815710 5:104585097-104585119 CAGCTGCTTAAGGGAAGCCAGGG + Intergenic
995638100 5:114219085-114219107 CAGCTGCTTTTGGGCACCAGCGG + Intergenic
995897733 5:117034269-117034291 CTCCTTCTCTGGGGCAGCCATGG - Intergenic
997202821 5:132023039-132023061 CAGCTGCTCAAGGGAAGCCTGGG - Intergenic
997337672 5:133119383-133119405 CAGGTGCTCTGGGGCAGACTGGG - Intergenic
997388847 5:133496992-133497014 CAGAGGCTCTTGGGGAGCCCAGG - Intronic
998215855 5:140238242-140238264 CAGCTGCTGTTGTGGAGCCTGGG + Intronic
999216533 5:149940373-149940395 CATCTCCTCTTGGGCATCCAGGG - Intronic
1000398093 5:160797018-160797040 CAGCTGCTTGGGGGCACCCAAGG + Intronic
1001831259 5:174791210-174791232 CAGCTTCCTTTGGCCAGCCACGG + Intergenic
1002372873 5:178768866-178768888 CCGCTGGACTTGGACAGCCATGG + Intergenic
1002700679 5:181122399-181122421 CAGCTGCTCCTCGGAAGCCTGGG + Intergenic
1003147072 6:3517677-3517699 CAGGTGCTCTGGGTAAGCCAGGG - Intergenic
1004160192 6:13206006-13206028 CAGCTGCAGTACGGCAGCCACGG + Exonic
1004732089 6:18367905-18367927 CAGCTGCTCGTGGGAATCCTTGG + Intergenic
1004986286 6:21086708-21086730 AAGCTGGTCTTGGGCAGTCGGGG - Intronic
1006347970 6:33498311-33498333 CAGTGGGTCATGGGCAGCCATGG - Intergenic
1006457828 6:34142195-34142217 CAGCAGCTCTTCTGCAGCCCCGG + Intronic
1006892494 6:37441061-37441083 AAGTTCCTCTTGGGCAGCCCAGG - Intronic
1014505433 6:122248462-122248484 CAGCTGCAGCTGGCCAGCCATGG - Intergenic
1016842704 6:148540472-148540494 AAGCTGCTCGTTGACAGCCAGGG + Exonic
1017418941 6:154252384-154252406 GAGCTCCTCTTGGCCAGGCACGG + Intronic
1017603825 6:156112017-156112039 CAGCAGCTCCTGGCGAGCCAAGG + Intergenic
1017958300 6:159198562-159198584 CAGCTGGACTTGGGGAGCCAAGG - Intronic
1018824499 6:167398940-167398962 CAGCCCCTCTGAGGCAGCCAGGG - Intergenic
1019567884 7:1693733-1693755 CACCTGCTCTGGGGTTGCCATGG - Exonic
1019760870 7:2811692-2811714 CAGCAGCCCTTGGGCAGCATTGG - Intronic
1019888020 7:3922232-3922254 CAGCTAAGCTCGGGCAGCCATGG + Intronic
1020212340 7:6166181-6166203 CAGAGGCCCTTGGGCAGCCCTGG + Intronic
1021485940 7:21168606-21168628 AAGGTGCTCTTTGGAAGCCATGG - Intergenic
1021924690 7:25522985-25523007 CAGTTTATCTTGGGCAGCCTGGG - Intergenic
1026689610 7:72540411-72540433 CATCTCCTCTTGGCCACCCAGGG + Intergenic
1029278689 7:99423314-99423336 CATGTGCTCATGGGCAGCCCTGG - Intronic
1029544295 7:101202182-101202204 CAGCTGTTCCTGGGCCGCCGGGG - Intergenic
1032690060 7:134276835-134276857 CCGCTCCTCAGGGGCAGCCAAGG + Intergenic
1033637193 7:143222961-143222983 CAACTGATCTTGGGCAACCCTGG + Exonic
1033883529 7:145916795-145916817 CAGCTGCTCTTTGCCAGCGAGGG - Intergenic
1034436747 7:151066235-151066257 CAACTGCTCCTCAGCAGCCAGGG - Intronic
1034492861 7:151403424-151403446 CAGCTGGTATTGGGTAGACAGGG + Intronic
1034574900 7:151988205-151988227 AAACTGCCCTTGGCCAGCCATGG - Intronic
1035373698 7:158394500-158394522 CAGGTGGGCTTGGACAGCCACGG - Intronic
1035453858 7:158996729-158996751 CCGCTGAGCTTGGGCAGCCTGGG - Intergenic
1035725498 8:1823286-1823308 CAGCTGCCCTGGACCAGCCAAGG - Intergenic
1037289612 8:17336761-17336783 CAGCTCCTCTGACGCAGCCAGGG - Intronic
1037492230 8:19407358-19407380 CAGCAGCTCGTGGGGAGCCTGGG + Intronic
1037921636 8:22810439-22810461 CAGATGCTCTTAGGAAGCGAGGG - Intronic
1040038396 8:42893749-42893771 GAGCAGCTCTGGGGCAGGCATGG - Intronic
1040417397 8:47207436-47207458 CAGCTGCCCTGGAGCAGCCCTGG - Intergenic
1040595212 8:48831900-48831922 CAGAGGCACTTGGGCAGCCCAGG - Intergenic
1040676130 8:49752672-49752694 CAGCTGGTCTTGAACATCCAGGG - Intergenic
1045255504 8:100517275-100517297 CTGGTACTCTTGGGCAGCAAAGG - Intronic
1046129945 8:109954577-109954599 CAGCTGGTTTTGGGCTGCCCAGG + Intergenic
1046950052 8:120011297-120011319 CCTGTGCTCTGGGGCAGCCATGG + Intronic
1047016099 8:120724935-120724957 CAGCTGCTCATGGGATTCCATGG + Intronic
1047072195 8:121357653-121357675 CAGCAGCTATTGTTCAGCCAGGG + Intergenic
1047275331 8:123401282-123401304 CAGCTGCTCATGGGAATCCTTGG - Intronic
1047771114 8:128030888-128030910 CACCTGCTCTAGGGCAGGCCTGG - Intergenic
1049105268 8:140608793-140608815 CAGCTGCTCCAGGGCAGCAAGGG + Intronic
1049133206 8:140867997-140868019 TAGCTGCTGTTGGGAATCCATGG - Intronic
1049339213 8:142102996-142103018 CAGCTTCTCCTGGCCAGCCTTGG + Intergenic
1049431101 8:142565431-142565453 CAGCAGCTCTTGGGCTCCCAAGG + Intergenic
1049497335 8:142942422-142942444 CAGCTGGTCGAGGGGAGCCATGG - Intergenic
1049858821 8:144883211-144883233 CAGCAGCACTTGGGCAGGCAGGG + Intronic
1053012588 9:34643083-34643105 CCCCAGCTCTTGGGAAGCCAGGG - Intronic
1053128190 9:35599575-35599597 CAGTTGGTCCTGGGCAGCCATGG - Intergenic
1053877405 9:42558372-42558394 CAGCTGCACTTGGGAGGGCAGGG + Intergenic
1054234290 9:62543350-62543372 CAGCTGCACTTGGGAGGGCAGGG - Intergenic
1057024596 9:91725452-91725474 CAGCTGCCCTGGGGCTGCCCCGG + Intronic
1060630335 9:125152084-125152106 CAGTTGGGCTTGAGCAGCCATGG + Intronic
1061459077 9:130721624-130721646 CACCTGCGCCTGGGAAGCCAAGG + Intronic
1061621215 9:131812471-131812493 CTGCTGCTTTGGGGCAGCCAGGG - Intergenic
1061806365 9:133139718-133139740 CCGCTGCCCTTGGGGAGCCAGGG - Intronic
1061919415 9:133774542-133774564 GTGCTGCTCTGAGGCAGCCAGGG - Intronic
1185599619 X:1329918-1329940 CCGCTGCTCTTCCGCAGCCTGGG - Intergenic
1187159949 X:16755019-16755041 GGCCTGCTGTTGGGCAGCCAGGG - Exonic
1188245567 X:27832472-27832494 CATGTGCTCATTGGCAGCCAGGG - Intergenic
1188312800 X:28638381-28638403 AAAATGCTCTTGGGAAGCCAGGG - Intronic
1190168439 X:48092436-48092458 CTGTTGCTCTTGGGCAGAGAAGG - Intergenic
1190168804 X:48095249-48095271 CTGTTGCTCTTGGGCAGAGAAGG + Intergenic
1192537292 X:71939066-71939088 AAGCTGGACTTGGGGAGCCAAGG + Intergenic
1193406415 X:81107297-81107319 CAGCTGCTTCAGGTCAGCCATGG + Intergenic
1194239124 X:91422433-91422455 CAGCTGCTCTGGGCTCGCCAGGG - Intergenic
1195702284 X:107714606-107714628 CAGCTGCTCTGGGCTTGCCAGGG + Exonic
1196722325 X:118865958-118865980 TAGATGCTCCTGTGCAGCCATGG - Intergenic
1197702579 X:129610330-129610352 CAGCTGCTCTTGGGAAACTCTGG - Intergenic
1199037119 X:143064298-143064320 GAGATGCTCTTTGGGAGCCATGG - Intergenic
1199868459 X:151875323-151875345 CTGCTGTTCTTGGGCAAGCAAGG - Intergenic
1200067770 X:153512378-153512400 CTGCTGCACAGGGGCAGCCAGGG + Intergenic
1200084017 X:153594119-153594141 CAGCTGTGCTTAGGAAGCCATGG - Intronic
1201458256 Y:14194525-14194547 CAGCTGCCCTCTGGCAGCAAGGG - Intergenic
1201561579 Y:15322806-15322828 AAGCTGCTCTTGGTCACACAGGG + Intergenic