ID: 1181492249

View in Genome Browser
Species Human (GRCh38)
Location 22:23267920-23267942
Sequence CTCTCTTCTGCAAAGACGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 142}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181492240_1181492249 21 Left 1181492240 22:23267876-23267898 CCCTCACCAGGCCCAGGATGGGC 0: 1
1: 0
2: 6
3: 34
4: 325
Right 1181492249 22:23267920-23267942 CTCTCTTCTGCAAAGACGGCCGG 0: 1
1: 0
2: 0
3: 16
4: 142
1181492243_1181492249 10 Left 1181492243 22:23267887-23267909 CCCAGGATGGGCTTGTGTCTGTG 0: 1
1: 0
2: 1
3: 16
4: 248
Right 1181492249 22:23267920-23267942 CTCTCTTCTGCAAAGACGGCCGG 0: 1
1: 0
2: 0
3: 16
4: 142
1181492242_1181492249 15 Left 1181492242 22:23267882-23267904 CCAGGCCCAGGATGGGCTTGTGT 0: 1
1: 0
2: 1
3: 22
4: 227
Right 1181492249 22:23267920-23267942 CTCTCTTCTGCAAAGACGGCCGG 0: 1
1: 0
2: 0
3: 16
4: 142
1181492244_1181492249 9 Left 1181492244 22:23267888-23267910 CCAGGATGGGCTTGTGTCTGTGC 0: 1
1: 0
2: 0
3: 12
4: 180
Right 1181492249 22:23267920-23267942 CTCTCTTCTGCAAAGACGGCCGG 0: 1
1: 0
2: 0
3: 16
4: 142
1181492236_1181492249 29 Left 1181492236 22:23267868-23267890 CCTGAGCACCCTCACCAGGCCCA No data
Right 1181492249 22:23267920-23267942 CTCTCTTCTGCAAAGACGGCCGG 0: 1
1: 0
2: 0
3: 16
4: 142
1181492241_1181492249 20 Left 1181492241 22:23267877-23267899 CCTCACCAGGCCCAGGATGGGCT 0: 1
1: 0
2: 3
3: 60
4: 470
Right 1181492249 22:23267920-23267942 CTCTCTTCTGCAAAGACGGCCGG 0: 1
1: 0
2: 0
3: 16
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181492249 Original CRISPR CTCTCTTCTGCAAAGACGGC CGG Intronic
900695332 1:4006146-4006168 CTGTTTTCTGCAATGACGGGAGG + Intergenic
900858855 1:5209957-5209979 CGCTCTTCTGCAAAGTCATCTGG - Intergenic
902398234 1:16143906-16143928 CCCCCTTCTGCAGAGACGACAGG - Intronic
902753617 1:18534840-18534862 CTCTGGTCTGCAAAGGAGGCGGG - Intergenic
905696726 1:39980036-39980058 CTCTCTTGTACAGAGACGGAGGG - Intergenic
905945056 1:41894934-41894956 TTCTCTTCTGCAAAGTGGCCAGG - Intronic
907689399 1:56646561-56646583 CTCTATTCTGGAGAGAAGGCAGG - Intronic
908823373 1:68111429-68111451 CTCTCTACAGAAAAGACAGCAGG - Intronic
909894394 1:81048378-81048400 CTTGCTTCTGCAAAGCCAGCAGG + Intergenic
910172060 1:84387985-84388007 CTCTCTTCTGGAGAGTGGGCAGG + Intronic
912023208 1:105133320-105133342 CTCTCTTCAGCAAACAGTGCTGG - Intergenic
914764550 1:150626526-150626548 CTCTCCTCTGCAATGACTGTAGG - Exonic
916024069 1:160819081-160819103 CTCTCTTCTGGAGGGATGGCAGG + Intronic
918409706 1:184245693-184245715 ATCTCTACTGCAAAGAGGACTGG - Intergenic
920195645 1:204224526-204224548 CTTTCTCTTGCACAGACGGCAGG - Intronic
920305569 1:205016147-205016169 TTCCCTTCTGCAAAGCAGGCTGG + Intronic
920641337 1:207754318-207754340 CGCTCTTCTGCAAACTCAGCTGG + Intronic
921497063 1:215854600-215854622 CTCTCTTCTGCAGAGAAAGAAGG + Intronic
1063054253 10:2485997-2486019 CTCTCAGCTGCAAAGCCAGCAGG + Intergenic
1065331521 10:24605371-24605393 CTGTTTCCTGCAAAGATGGCAGG - Intronic
1065967182 10:30779820-30779842 CTCTCTTCTGCATACTCTGCAGG + Intergenic
1066100079 10:32110000-32110022 CTGACTTCTGCAAAGATGGCCGG - Intergenic
1068173949 10:53432381-53432403 CTGTATTCTGGAAAGACAGCAGG + Intergenic
1070552484 10:77501665-77501687 CTCTCTTCTGCAGAGACGAGGGG - Intronic
1071616048 10:87077516-87077538 ACCACTTCTGCAAAGAGGGCAGG + Intronic
1074020024 10:109572982-109573004 CTCTCTTCTGCCAGGAGGACTGG - Intergenic
1074743418 10:116506960-116506982 CTCTTTGCTGCAAACACAGCTGG - Intergenic
1075019304 10:118938545-118938567 ATCTCTTCAGCAAATACTGCTGG + Intergenic
1075967609 10:126626193-126626215 CTCTCTTCTGAACAGAAGGTGGG + Intronic
1079881192 11:25929139-25929161 CTTTCTTCTGTAAAGAAGACAGG - Intergenic
1079915196 11:26360919-26360941 CTCATTTCTACAAAGACGTCAGG - Intronic
1082121665 11:48385690-48385712 CTCTCTTCTGCAGAGACAAAGGG + Intergenic
1082252187 11:49994928-49994950 CTCTCTTCTGCAGAGACAGAGGG - Intergenic
1082555651 11:54559945-54559967 CTCTCTTCTGCAGAGACAGAGGG + Intergenic
1084598018 11:70128721-70128743 CTCTCTTCTTCAGAGAGGACCGG - Intronic
1086882739 11:92169042-92169064 CTCTCATCTCCCAAGACGGTGGG + Intergenic
1090627799 11:128621220-128621242 CTTTCTTCTGCAATGGGGGCAGG - Intergenic
1090630679 11:128644482-128644504 CTCCCTTCTGCATGGACTGCTGG - Intergenic
1091893400 12:4081319-4081341 CCCTCATCTGCAAATAGGGCAGG - Intergenic
1093089409 12:14904638-14904660 TTATCTTCTGCAAAGACGGAGGG - Intronic
1094475419 12:30837003-30837025 TTCTCTTCTACAAAGAGGGCAGG - Intergenic
1100281797 12:93125299-93125321 CTCACTCCTGCAAAGACTGTTGG - Intergenic
1105219471 13:18312333-18312355 CCATCTCCTGCAAAGAAGGCTGG + Intergenic
1105843977 13:24279280-24279302 CTCTTGGCTGCAAAGACCGCAGG - Intronic
1106387597 13:29302723-29302745 CTGTCTTCTCCAAAGTCAGCAGG - Intronic
1107029926 13:35840101-35840123 CTCTCTGCTCCACAGACAGCCGG - Intronic
1117976390 14:61301063-61301085 CTCTCTCCTGCAGAGAGAGCGGG - Intronic
1118007218 14:61574266-61574288 CTCATTTCTGCAGAGAGGGCTGG - Intronic
1120399157 14:84006325-84006347 TTCTCCTTTGCAAAGACTGCAGG - Intergenic
1123691221 15:22839750-22839772 CTCTCTTATGAAAAAAAGGCTGG - Exonic
1127068752 15:55267477-55267499 CTCTGCTCTGCCAAGAGGGCAGG + Intronic
1129329203 15:74818224-74818246 CTCTCTTCTGCCAAGGGAGCAGG + Intronic
1129660577 15:77550755-77550777 CTCCCTTCTGCTAACAGGGCAGG - Intergenic
1134426242 16:14149031-14149053 CTCTCTTCTTTAAATATGGCAGG - Intronic
1135182972 16:20291454-20291476 CACTCTTCTGGAATGACTGCAGG - Intergenic
1140196358 16:72858846-72858868 CTCCCTTCTGGAAAGCCGGCCGG + Intronic
1141092151 16:81137659-81137681 CTCCCTTCTGCAGAGATGGGAGG + Intergenic
1142498447 17:319423-319445 CGGTGTTCTGCAAAGACTGCAGG - Exonic
1143101164 17:4505604-4505626 GTCTCTTCTGCAGATAGGGCTGG + Intronic
1143466426 17:7139844-7139866 CTCTCTCCTGCAGAGAGGGAGGG + Intergenic
1150265138 17:63827465-63827487 CTCTCTTCAGCAGAGACCGCCGG - Exonic
1152345188 17:79747131-79747153 CTCTCCTCTGCACTGACGTCCGG + Intergenic
1155441289 18:25865158-25865180 ATTTCTTCTGCAAAGACTGCAGG + Intergenic
1156602856 18:38630769-38630791 TGCTCTTCTGCAAAGAGGGTTGG + Intergenic
1157005970 18:43585301-43585323 AACTATTCTGCAAAGACAGCTGG - Intergenic
1158146521 18:54320301-54320323 CTCTCTCATGCAAAGAAGGCTGG + Intronic
1160736496 19:664995-665017 CGCGCTGCTGCAAAGACGACTGG - Intergenic
1161873081 19:6885670-6885692 CTCTCTCCTGCAAAGAGAGGGGG - Intergenic
1163215690 19:15875366-15875388 CTCTCTTCTGCAGAGAAAGAGGG - Intergenic
1163227730 19:15976692-15976714 CTCTCTTCTGCAGAGAGAGAGGG + Intergenic
1164837487 19:31366683-31366705 CTCTCTTCTCCACACACTGCAGG + Intergenic
1165551271 19:36588390-36588412 TTCTCCTATGCAAAGACAGCAGG - Intronic
1166107260 19:40603576-40603598 CTCTCGAGTTCAAAGACGGCTGG - Intronic
1167626239 19:50591618-50591640 CTCTCTCCTGCAGAGAGGGAGGG + Intergenic
925649129 2:6070233-6070255 CTCTGTTCTCAAAAGACAGCAGG + Intergenic
926226368 2:10969892-10969914 CTGTCTTCTGGAAAGACTGCTGG - Intergenic
927202106 2:20584259-20584281 CTCTCTTCTGCCAGCATGGCTGG - Intronic
927454991 2:23241562-23241584 CTCTCTCCTCCAAAGAGAGCAGG - Intergenic
931412288 2:62044603-62044625 ATCTATTCTGCAAAGATGCCAGG - Intronic
931835359 2:66093349-66093371 ATCTCTTCTGGAAAGATGGCTGG + Intergenic
931969608 2:67571289-67571311 CTCTCCTCTTCAAAGTGGGCAGG + Intergenic
932804582 2:74772203-74772225 CTCTCTTCTTCCAAGACTTCTGG - Intergenic
934184577 2:89660184-89660206 CCATCTCCTGCAAAGAAGGCTGG - Intergenic
934294859 2:91734322-91734344 CCATCTCCTGCAAAGAAGGCTGG - Intergenic
940979940 2:159990330-159990352 CTCTCTCCTGCAAACACGAATGG + Intronic
945048631 2:205802811-205802833 CTCCCTTCTGCACAGACGGTGGG + Intergenic
946052453 2:216875177-216875199 CTCTCTGCTTCAAAGAAGGGAGG - Intergenic
946461425 2:219872254-219872276 CTCTCTGCTGCAAAAACAACTGG - Intergenic
947092363 2:226526505-226526527 CTCTCTGATGTAAAGACAGCTGG - Intergenic
948751652 2:240136587-240136609 GACTCTGCCGCAAAGACGGCCGG + Intronic
1172609997 20:36243551-36243573 CTCTCTACTTCAAAGGTGGCTGG - Intronic
1174581871 20:51578029-51578051 CTCCTTTCTGCAAAGACAGGGGG + Intergenic
1176307245 21:5130215-5130237 CTCCCTTCTACAAAGACCTCTGG + Intergenic
1178764702 21:35439309-35439331 CTGTCTTGTTCAAAGACAGCTGG - Intronic
1179849814 21:44131815-44131837 CTCCCTTCTACAAAGACCTCTGG - Intergenic
1180817073 22:18797193-18797215 CCATCTCCTGCAAAGAAGGCTGG + Intergenic
1181203262 22:21231538-21231560 CCATCTCCTGCAAAGAAGGCTGG + Intergenic
1181464007 22:23101189-23101211 TCCTCATCTGCAAAGCCGGCTGG - Intronic
1181492249 22:23267920-23267942 CTCTCTTCTGCAAAGACGGCCGG + Intronic
1183319592 22:37156938-37156960 CTGTCTTCTGGAAAGTCAGCAGG + Intronic
1185091432 22:48777766-48777788 CTGTCTCCTGTAAAGATGGCAGG + Intronic
1185340702 22:50289679-50289701 CTGTCTTCAGCAGAGACAGCCGG - Exonic
1185363509 22:50423446-50423468 CTTTCTTCTGCAAACACAGAAGG - Exonic
1185404666 22:50641117-50641139 CACACTTCTGCAAAAATGGCTGG - Intergenic
1203223657 22_KI270731v1_random:63886-63908 CCATCTCCTGCAAAGAAGGCTGG - Intergenic
1203267172 22_KI270734v1_random:22914-22936 CCATCTCCTGCAAAGAAGGCTGG + Intergenic
949905233 3:8853300-8853322 CTCACATCTGCAAAGCCAGCAGG - Intronic
953169486 3:40494370-40494392 CTTTCTTCAGGAAAGACGGATGG + Intergenic
956291457 3:67664531-67664553 CTCACTTCAGCAAAGAAAGCAGG + Intergenic
956688766 3:71856858-71856880 CTCTCTTCTGCACCTAGGGCTGG - Intergenic
956857601 3:73291375-73291397 CTCCCTTCTGCCAAGGCGGAAGG - Intergenic
959986649 3:112580689-112580711 CTCACTTCTGAAAAGAAGGCAGG - Exonic
961564944 3:127756684-127756706 TTCTCTTCTGAAAAGAAGTCTGG - Intronic
966454770 3:180102401-180102423 CTGTATTCTTCAAAGCCGGCAGG - Intergenic
970063757 4:12067542-12067564 CTCTCTTCTGCAAAATAGGAGGG + Intergenic
970142662 4:12998908-12998930 CTCTGTTCTGAAAAGGCAGCAGG + Intergenic
972593643 4:40511249-40511271 CTCTGTTCAGAAAAGACAGCAGG + Intronic
973268795 4:48238735-48238757 CACTTTACTGCAAAGAAGGCTGG - Intronic
976551211 4:86397508-86397530 CTCTCTTCTTCAAAGATGTTTGG - Intronic
980869249 4:138592554-138592576 CTCTCCTCTCCAAACAAGGCTGG - Intergenic
982136958 4:152281300-152281322 CCCTCCTCTGCAAAGTCGCCAGG + Intergenic
985707197 5:1408423-1408445 CTCTCTTCTGTAAAATGGGCAGG - Intronic
992025022 5:72661677-72661699 CACACCTCTGCAAAGAAGGCTGG + Intergenic
997758548 5:136422971-136422993 TTCTGTTCTGAAAAGACAGCTGG + Intergenic
998695073 5:144629724-144629746 CTCACTTCTGCAAAGACAGAAGG - Intergenic
1009579866 6:65518339-65518361 ATCTCTTCTCCAAAAAGGGCAGG + Intronic
1016207328 6:141484981-141485003 CTCACTTCTGCAAAGTAGGTAGG - Intergenic
1018179346 6:161207141-161207163 CTCTCTTTTGCAAAGAAGTGTGG + Intronic
1018404463 6:163463890-163463912 CACTCTTCTGTAAAAATGGCAGG + Intronic
1019436914 7:1027307-1027329 CTCACGGCTGCAGAGACGGCGGG - Intronic
1022032476 7:26504958-26504980 CTCTCTCCTGCAGAGACAGGAGG - Intergenic
1028833570 7:95350305-95350327 AGCTCTTCTGCTAAAACGGCAGG + Intergenic
1031978991 7:128112322-128112344 CTCTTTTCTGCAAAATCAGCAGG - Intergenic
1034924011 7:155106412-155106434 GTGTCTTCTGTGAAGACGGCAGG + Intergenic
1035133252 7:156675302-156675324 CCCTCGTCTCCAAAGACGGAGGG - Intronic
1035721424 8:1796326-1796348 CCGTCTTCTGCAAAGCAGGCAGG - Intergenic
1036652567 8:10654719-10654741 TTCTCTTCTGCAAGGCCTGCTGG - Intronic
1037996692 8:23357680-23357702 CTTTCTTATGCCAAGAAGGCTGG + Intronic
1038265529 8:26037135-26037157 CTCTCTCCTTCAAAGACTCCGGG - Intronic
1038406759 8:27327803-27327825 CTCTTTTCTGAAATGAGGGCAGG + Intronic
1039018447 8:33179408-33179430 ATCTCTCCTGCCAAGAAGGCAGG + Intergenic
1039235524 8:35498354-35498376 CTCTCTTCTTCACAGAAGGATGG - Intronic
1039443688 8:37613380-37613402 CTCTCTCCTGCAAAGATGGGAGG - Intergenic
1039811808 8:41055528-41055550 TTCTCTTCTGCAGAGAAGACAGG - Intergenic
1042629995 8:70805784-70805806 TGCTGTTCTGCAAAGACTGCAGG - Intergenic
1047313067 8:123708508-123708530 CTCTCTTCTGCTAGCACTGCTGG + Intronic
1047890608 8:129303974-129303996 CTCTCCTGTGCAGAGACAGCAGG - Intergenic
1049103748 8:140598295-140598317 TTCTCTTCGGCAAAGGCAGCAGG + Intronic
1049119760 8:140724801-140724823 TTGTTTTCTGCAAAGACGGTAGG - Intronic
1056841458 9:90001231-90001253 CTCTCTTCTGACATGACGGATGG - Intergenic
1056856829 9:90138778-90138800 CACTCAGCTGCAAAGATGGCAGG - Intergenic
1059142638 9:111868786-111868808 CTCTCTCCTGCAGAGATGGGGGG - Intergenic
1059890032 9:118791483-118791505 CTCTTTTCTACAAAGACATCAGG - Intergenic
1060073059 9:120567358-120567380 CTCTGTTCTGTAAAGACAACTGG + Intronic
1061972159 9:134050684-134050706 CTCTGTGCTGCCAAGACCGCCGG + Intronic
1186635214 X:11396441-11396463 CTCTCTCCTCCAGAGAGGGCAGG + Intronic
1187470050 X:19561569-19561591 CTCACATCTGCAAAGATGGAAGG - Intronic
1198755018 X:139973657-139973679 CACTCTTCTGCAGAGACCACAGG + Intergenic
1200006407 X:153088107-153088129 ATCCCTTCTGCAAGGACTGCTGG + Intergenic