ID: 1181495356

View in Genome Browser
Species Human (GRCh38)
Location 22:23284490-23284512
Sequence CTGGGTGAACCCAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181495356_1181495370 17 Left 1181495356 22:23284490-23284512 CCCTCCTCCCTGGGTTCACCCAG No data
Right 1181495370 22:23284530-23284552 TGGAGCAAAGAGGGCCACACTGG 0: 1
1: 0
2: 4
3: 39
4: 473
1181495356_1181495371 18 Left 1181495356 22:23284490-23284512 CCCTCCTCCCTGGGTTCACCCAG No data
Right 1181495371 22:23284531-23284553 GGAGCAAAGAGGGCCACACTGGG 0: 1
1: 1
2: 3
3: 14
4: 198
1181495356_1181495372 22 Left 1181495356 22:23284490-23284512 CCCTCCTCCCTGGGTTCACCCAG No data
Right 1181495372 22:23284535-23284557 CAAAGAGGGCCACACTGGGAAGG 0: 1
1: 0
2: 2
3: 30
4: 248
1181495356_1181495366 -3 Left 1181495356 22:23284490-23284512 CCCTCCTCCCTGGGTTCACCCAG No data
Right 1181495366 22:23284510-23284532 CAGGTTGCACCAGGTTGGAATGG 0: 1
1: 0
2: 2
3: 46
4: 1822
1181495356_1181495369 8 Left 1181495356 22:23284490-23284512 CCCTCCTCCCTGGGTTCACCCAG No data
Right 1181495369 22:23284521-23284543 AGGTTGGAATGGAGCAAAGAGGG 0: 1
1: 0
2: 6
3: 57
4: 651
1181495356_1181495368 7 Left 1181495356 22:23284490-23284512 CCCTCCTCCCTGGGTTCACCCAG No data
Right 1181495368 22:23284520-23284542 CAGGTTGGAATGGAGCAAAGAGG 0: 1
1: 0
2: 3
3: 17
4: 353
1181495356_1181495363 -8 Left 1181495356 22:23284490-23284512 CCCTCCTCCCTGGGTTCACCCAG No data
Right 1181495363 22:23284505-23284527 TCACCCAGGTTGCACCAGGTTGG 0: 1
1: 0
2: 1
3: 11
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181495356 Original CRISPR CTGGGTGAACCCAGGGAGGA GGG (reversed) Intronic
No off target data available for this crispr