ID: 1181507832

View in Genome Browser
Species Human (GRCh38)
Location 22:23373617-23373639
Sequence ACCATCTTTGGTGAGTCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 46}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181507832_1181507842 20 Left 1181507832 22:23373617-23373639 CCCACGGACTCACCAAAGATGGT 0: 1
1: 0
2: 1
3: 6
4: 46
Right 1181507842 22:23373660-23373682 CGAAGAACTCGATGTTCTTCTGG No data
1181507832_1181507837 -10 Left 1181507832 22:23373617-23373639 CCCACGGACTCACCAAAGATGGT 0: 1
1: 0
2: 1
3: 6
4: 46
Right 1181507837 22:23373630-23373652 CAAAGATGGTCACAGAGCTGGGG No data
1181507832_1181507843 27 Left 1181507832 22:23373617-23373639 CCCACGGACTCACCAAAGATGGT 0: 1
1: 0
2: 1
3: 6
4: 46
Right 1181507843 22:23373667-23373689 CTCGATGTTCTTCTGGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181507832 Original CRISPR ACCATCTTTGGTGAGTCCGT GGG (reversed) Intergenic