ID: 1181507833

View in Genome Browser
Species Human (GRCh38)
Location 22:23373618-23373640
Sequence GACCATCTTTGGTGAGTCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 1, 2: 1, 3: 5, 4: 60}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181507833_1181507842 19 Left 1181507833 22:23373618-23373640 CCACGGACTCACCAAAGATGGTC 0: 1
1: 1
2: 1
3: 5
4: 60
Right 1181507842 22:23373660-23373682 CGAAGAACTCGATGTTCTTCTGG No data
1181507833_1181507843 26 Left 1181507833 22:23373618-23373640 CCACGGACTCACCAAAGATGGTC 0: 1
1: 1
2: 1
3: 5
4: 60
Right 1181507843 22:23373667-23373689 CTCGATGTTCTTCTGGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181507833 Original CRISPR GACCATCTTTGGTGAGTCCG TGG (reversed) Intergenic