ID: 1181507835

View in Genome Browser
Species Human (GRCh38)
Location 22:23373629-23373651
Sequence CCCAGCTCTGTGACCATCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181507835_1181507842 8 Left 1181507835 22:23373629-23373651 CCAAAGATGGTCACAGAGCTGGG No data
Right 1181507842 22:23373660-23373682 CGAAGAACTCGATGTTCTTCTGG No data
1181507835_1181507843 15 Left 1181507835 22:23373629-23373651 CCAAAGATGGTCACAGAGCTGGG No data
Right 1181507843 22:23373667-23373689 CTCGATGTTCTTCTGGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181507835 Original CRISPR CCCAGCTCTGTGACCATCTT TGG (reversed) Intergenic