ID: 1181507839

View in Genome Browser
Species Human (GRCh38)
Location 22:23373655-23373677
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181507839_1181507845 6 Left 1181507839 22:23373655-23373677 CCCACCGAAGAACTCGATGTTCT No data
Right 1181507845 22:23373684-23373706 CCCAGGATAGAGCAGCCACCTGG 0: 1
1: 1
2: 2
3: 32
4: 211
1181507839_1181507850 28 Left 1181507839 22:23373655-23373677 CCCACCGAAGAACTCGATGTTCT No data
Right 1181507850 22:23373706-23373728 GTCCTTGAAGGCCCAGTTCCCGG 0: 1
1: 0
2: 1
3: 13
4: 174
1181507839_1181507847 16 Left 1181507839 22:23373655-23373677 CCCACCGAAGAACTCGATGTTCT No data
Right 1181507847 22:23373694-23373716 AGCAGCCACCTGGTCCTTGAAGG No data
1181507839_1181507851 29 Left 1181507839 22:23373655-23373677 CCCACCGAAGAACTCGATGTTCT No data
Right 1181507851 22:23373707-23373729 TCCTTGAAGGCCCAGTTCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181507839 Original CRISPR AGAACATCGAGTTCTTCGGT GGG (reversed) Intergenic