ID: 1181507843

View in Genome Browser
Species Human (GRCh38)
Location 22:23373667-23373689
Sequence CTCGATGTTCTTCTGGACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181507838_1181507843 -10 Left 1181507838 22:23373654-23373676 CCCCACCGAAGAACTCGATGTTC No data
Right 1181507843 22:23373667-23373689 CTCGATGTTCTTCTGGACCCAGG No data
1181507832_1181507843 27 Left 1181507832 22:23373617-23373639 CCCACGGACTCACCAAAGATGGT 0: 1
1: 0
2: 1
3: 6
4: 46
Right 1181507843 22:23373667-23373689 CTCGATGTTCTTCTGGACCCAGG No data
1181507835_1181507843 15 Left 1181507835 22:23373629-23373651 CCAAAGATGGTCACAGAGCTGGG No data
Right 1181507843 22:23373667-23373689 CTCGATGTTCTTCTGGACCCAGG No data
1181507833_1181507843 26 Left 1181507833 22:23373618-23373640 CCACGGACTCACCAAAGATGGTC 0: 1
1: 1
2: 1
3: 5
4: 60
Right 1181507843 22:23373667-23373689 CTCGATGTTCTTCTGGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181507843 Original CRISPR CTCGATGTTCTTCTGGACCC AGG Intergenic