ID: 1181507844

View in Genome Browser
Species Human (GRCh38)
Location 22:23373684-23373706
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181507844_1181507851 0 Left 1181507844 22:23373684-23373706 CCCAGGATAGAGCAGCCACCTGG 0: 1
1: 1
2: 1
3: 28
4: 181
Right 1181507851 22:23373707-23373729 TCCTTGAAGGCCCAGTTCCCGGG No data
1181507844_1181507857 25 Left 1181507844 22:23373684-23373706 CCCAGGATAGAGCAGCCACCTGG 0: 1
1: 1
2: 1
3: 28
4: 181
Right 1181507857 22:23373732-23373754 CGTGCTGATCCCATGTGCTGAGG 0: 1
1: 1
2: 0
3: 8
4: 101
1181507844_1181507850 -1 Left 1181507844 22:23373684-23373706 CCCAGGATAGAGCAGCCACCTGG 0: 1
1: 1
2: 1
3: 28
4: 181
Right 1181507850 22:23373706-23373728 GTCCTTGAAGGCCCAGTTCCCGG 0: 1
1: 0
2: 1
3: 13
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181507844 Original CRISPR CCAGGTGGCTGCTCTATCCT GGG (reversed) Intergenic