ID: 1181507845

View in Genome Browser
Species Human (GRCh38)
Location 22:23373684-23373706
Sequence CCCAGGATAGAGCAGCCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 1, 2: 2, 3: 32, 4: 211}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181507838_1181507845 7 Left 1181507838 22:23373654-23373676 CCCCACCGAAGAACTCGATGTTC No data
Right 1181507845 22:23373684-23373706 CCCAGGATAGAGCAGCCACCTGG 0: 1
1: 1
2: 2
3: 32
4: 211
1181507839_1181507845 6 Left 1181507839 22:23373655-23373677 CCCACCGAAGAACTCGATGTTCT No data
Right 1181507845 22:23373684-23373706 CCCAGGATAGAGCAGCCACCTGG 0: 1
1: 1
2: 2
3: 32
4: 211
1181507840_1181507845 5 Left 1181507840 22:23373656-23373678 CCACCGAAGAACTCGATGTTCTT No data
Right 1181507845 22:23373684-23373706 CCCAGGATAGAGCAGCCACCTGG 0: 1
1: 1
2: 2
3: 32
4: 211
1181507841_1181507845 2 Left 1181507841 22:23373659-23373681 CCGAAGAACTCGATGTTCTTCTG No data
Right 1181507845 22:23373684-23373706 CCCAGGATAGAGCAGCCACCTGG 0: 1
1: 1
2: 2
3: 32
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181507845 Original CRISPR CCCAGGATAGAGCAGCCACC TGG Intergenic