ID: 1181507846

View in Genome Browser
Species Human (GRCh38)
Location 22:23373685-23373707
Sequence ACCAGGTGGCTGCTCTATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 1, 2: 1, 3: 13, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181507846_1181507857 24 Left 1181507846 22:23373685-23373707 CCAGGATAGAGCAGCCACCTGGT 0: 1
1: 1
2: 1
3: 13
4: 138
Right 1181507857 22:23373732-23373754 CGTGCTGATCCCATGTGCTGAGG 0: 1
1: 1
2: 0
3: 8
4: 101
1181507846_1181507851 -1 Left 1181507846 22:23373685-23373707 CCAGGATAGAGCAGCCACCTGGT 0: 1
1: 1
2: 1
3: 13
4: 138
Right 1181507851 22:23373707-23373729 TCCTTGAAGGCCCAGTTCCCGGG No data
1181507846_1181507850 -2 Left 1181507846 22:23373685-23373707 CCAGGATAGAGCAGCCACCTGGT 0: 1
1: 1
2: 1
3: 13
4: 138
Right 1181507850 22:23373706-23373728 GTCCTTGAAGGCCCAGTTCCCGG 0: 1
1: 0
2: 1
3: 13
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181507846 Original CRISPR ACCAGGTGGCTGCTCTATCC TGG (reversed) Intergenic