ID: 1181507847

View in Genome Browser
Species Human (GRCh38)
Location 22:23373694-23373716
Sequence AGCAGCCACCTGGTCCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181507838_1181507847 17 Left 1181507838 22:23373654-23373676 CCCCACCGAAGAACTCGATGTTC No data
Right 1181507847 22:23373694-23373716 AGCAGCCACCTGGTCCTTGAAGG No data
1181507841_1181507847 12 Left 1181507841 22:23373659-23373681 CCGAAGAACTCGATGTTCTTCTG No data
Right 1181507847 22:23373694-23373716 AGCAGCCACCTGGTCCTTGAAGG No data
1181507840_1181507847 15 Left 1181507840 22:23373656-23373678 CCACCGAAGAACTCGATGTTCTT No data
Right 1181507847 22:23373694-23373716 AGCAGCCACCTGGTCCTTGAAGG No data
1181507839_1181507847 16 Left 1181507839 22:23373655-23373677 CCCACCGAAGAACTCGATGTTCT No data
Right 1181507847 22:23373694-23373716 AGCAGCCACCTGGTCCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181507847 Original CRISPR AGCAGCCACCTGGTCCTTGA AGG Intergenic