ID: 1181507851

View in Genome Browser
Species Human (GRCh38)
Location 22:23373707-23373729
Sequence TCCTTGAAGGCCCAGTTCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181507846_1181507851 -1 Left 1181507846 22:23373685-23373707 CCAGGATAGAGCAGCCACCTGGT 0: 1
1: 1
2: 1
3: 13
4: 138
Right 1181507851 22:23373707-23373729 TCCTTGAAGGCCCAGTTCCCGGG No data
1181507839_1181507851 29 Left 1181507839 22:23373655-23373677 CCCACCGAAGAACTCGATGTTCT No data
Right 1181507851 22:23373707-23373729 TCCTTGAAGGCCCAGTTCCCGGG No data
1181507840_1181507851 28 Left 1181507840 22:23373656-23373678 CCACCGAAGAACTCGATGTTCTT No data
Right 1181507851 22:23373707-23373729 TCCTTGAAGGCCCAGTTCCCGGG No data
1181507838_1181507851 30 Left 1181507838 22:23373654-23373676 CCCCACCGAAGAACTCGATGTTC No data
Right 1181507851 22:23373707-23373729 TCCTTGAAGGCCCAGTTCCCGGG No data
1181507841_1181507851 25 Left 1181507841 22:23373659-23373681 CCGAAGAACTCGATGTTCTTCTG No data
Right 1181507851 22:23373707-23373729 TCCTTGAAGGCCCAGTTCCCGGG No data
1181507844_1181507851 0 Left 1181507844 22:23373684-23373706 CCCAGGATAGAGCAGCCACCTGG 0: 1
1: 1
2: 1
3: 28
4: 181
Right 1181507851 22:23373707-23373729 TCCTTGAAGGCCCAGTTCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181507851 Original CRISPR TCCTTGAAGGCCCAGTTCCC GGG Intergenic