ID: 1181507857

View in Genome Browser
Species Human (GRCh38)
Location 22:23373732-23373754
Sequence CGTGCTGATCCCATGTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 101}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181507854_1181507857 -9 Left 1181507854 22:23373718-23373740 CCAGTTCCCGGGAGCGTGCTGAT 0: 1
1: 0
2: 1
3: 3
4: 43
Right 1181507857 22:23373732-23373754 CGTGCTGATCCCATGTGCTGAGG 0: 1
1: 1
2: 0
3: 8
4: 101
1181507852_1181507857 1 Left 1181507852 22:23373708-23373730 CCTTGAAGGCCCAGTTCCCGGGA 0: 1
1: 1
2: 2
3: 11
4: 139
Right 1181507857 22:23373732-23373754 CGTGCTGATCCCATGTGCTGAGG 0: 1
1: 1
2: 0
3: 8
4: 101
1181507849_1181507857 7 Left 1181507849 22:23373702-23373724 CCTGGTCCTTGAAGGCCCAGTTC No data
Right 1181507857 22:23373732-23373754 CGTGCTGATCCCATGTGCTGAGG 0: 1
1: 1
2: 0
3: 8
4: 101
1181507848_1181507857 10 Left 1181507848 22:23373699-23373721 CCACCTGGTCCTTGAAGGCCCAG No data
Right 1181507857 22:23373732-23373754 CGTGCTGATCCCATGTGCTGAGG 0: 1
1: 1
2: 0
3: 8
4: 101
1181507853_1181507857 -8 Left 1181507853 22:23373717-23373739 CCCAGTTCCCGGGAGCGTGCTGA 0: 1
1: 0
2: 1
3: 2
4: 57
Right 1181507857 22:23373732-23373754 CGTGCTGATCCCATGTGCTGAGG 0: 1
1: 1
2: 0
3: 8
4: 101
1181507844_1181507857 25 Left 1181507844 22:23373684-23373706 CCCAGGATAGAGCAGCCACCTGG 0: 1
1: 1
2: 1
3: 28
4: 181
Right 1181507857 22:23373732-23373754 CGTGCTGATCCCATGTGCTGAGG 0: 1
1: 1
2: 0
3: 8
4: 101
1181507846_1181507857 24 Left 1181507846 22:23373685-23373707 CCAGGATAGAGCAGCCACCTGGT 0: 1
1: 1
2: 1
3: 13
4: 138
Right 1181507857 22:23373732-23373754 CGTGCTGATCCCATGTGCTGAGG 0: 1
1: 1
2: 0
3: 8
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181507857 Original CRISPR CGTGCTGATCCCATGTGCTG AGG Intergenic