ID: 1181509327

View in Genome Browser
Species Human (GRCh38)
Location 22:23381984-23382006
Sequence CACGTGCCCCCGGCGGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 133}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181509309_1181509327 28 Left 1181509309 22:23381933-23381955 CCCTGCCCCTTTTTGAGCCCCTG No data
Right 1181509327 22:23381984-23382006 CACGTGCCCCCGGCGGGGGATGG 0: 1
1: 0
2: 0
3: 15
4: 133
1181509316_1181509327 10 Left 1181509316 22:23381951-23381973 CCCTGTACTCACCTAGGAAATGG 0: 1
1: 0
2: 2
3: 18
4: 229
Right 1181509327 22:23381984-23382006 CACGTGCCCCCGGCGGGGGATGG 0: 1
1: 0
2: 0
3: 15
4: 133
1181509315_1181509327 11 Left 1181509315 22:23381950-23381972 CCCCTGTACTCACCTAGGAAATG 0: 1
1: 0
2: 2
3: 18
4: 217
Right 1181509327 22:23381984-23382006 CACGTGCCCCCGGCGGGGGATGG 0: 1
1: 0
2: 0
3: 15
4: 133
1181509318_1181509327 9 Left 1181509318 22:23381952-23381974 CCTGTACTCACCTAGGAAATGGG 0: 1
1: 0
2: 3
3: 12
4: 119
Right 1181509327 22:23381984-23382006 CACGTGCCCCCGGCGGGGGATGG 0: 1
1: 0
2: 0
3: 15
4: 133
1181509313_1181509327 21 Left 1181509313 22:23381940-23381962 CCTTTTTGAGCCCCTGTACTCAC No data
Right 1181509327 22:23381984-23382006 CACGTGCCCCCGGCGGGGGATGG 0: 1
1: 0
2: 0
3: 15
4: 133
1181509310_1181509327 27 Left 1181509310 22:23381934-23381956 CCTGCCCCTTTTTGAGCCCCTGT No data
Right 1181509327 22:23381984-23382006 CACGTGCCCCCGGCGGGGGATGG 0: 1
1: 0
2: 0
3: 15
4: 133
1181509311_1181509327 23 Left 1181509311 22:23381938-23381960 CCCCTTTTTGAGCCCCTGTACTC No data
Right 1181509327 22:23381984-23382006 CACGTGCCCCCGGCGGGGGATGG 0: 1
1: 0
2: 0
3: 15
4: 133
1181509312_1181509327 22 Left 1181509312 22:23381939-23381961 CCCTTTTTGAGCCCCTGTACTCA No data
Right 1181509327 22:23381984-23382006 CACGTGCCCCCGGCGGGGGATGG 0: 1
1: 0
2: 0
3: 15
4: 133
1181509321_1181509327 -1 Left 1181509321 22:23381962-23381984 CCTAGGAAATGGGTGATAAAGGC 0: 1
1: 2
2: 8
3: 19
4: 184
Right 1181509327 22:23381984-23382006 CACGTGCCCCCGGCGGGGGATGG 0: 1
1: 0
2: 0
3: 15
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181509327 Original CRISPR CACGTGCCCCCGGCGGGGGA TGG Intergenic
900872102 1:5311454-5311476 CACGGGCACCAGGCTGGGGAAGG + Intergenic
902143023 1:14372565-14372587 CACATGCCCCATGCGGGAGAGGG + Intergenic
902585734 1:17437958-17437980 CCCGGGCCCGCGGCGGGGGAGGG - Intronic
903767931 1:25746790-25746812 CAGAGGCCCTCGGCGGGGGAGGG + Intronic
907221963 1:52913712-52913734 CACGTGCCTCTGGTGGGGGATGG - Intronic
910449953 1:87334751-87334773 CACTTGGCCGCGGAGGGGGAGGG - Intronic
911222493 1:95263608-95263630 CACATGCCGGGGGCGGGGGAAGG - Intergenic
912416239 1:109509767-109509789 CGCGTGCGCGCGGCGGGGGCGGG + Intergenic
912505094 1:110150763-110150785 CACAGGCCCCCGGCTGGGGCTGG - Exonic
920878422 1:209858731-209858753 CAGGAGCCCACGGCGGGGGTGGG + Intergenic
1063369605 10:5512521-5512543 CAGGTGCCCACGGCGAGGAAGGG - Intergenic
1067773177 10:49142079-49142101 CACTTGCTCCTGGCCGGGGAGGG - Intergenic
1071601750 10:86961873-86961895 CACCTGCCTCTGGCGGGGGACGG - Intronic
1075430397 10:122375119-122375141 CAGCGGCGCCCGGCGGGGGAGGG + Intronic
1076297137 10:129394918-129394940 CAAGTGCACCCGGCGGGGTGGGG - Intergenic
1077147407 11:1052342-1052364 CAGGTGCCCCAGGAGGGGGAGGG - Intergenic
1077177312 11:1196722-1196744 TACGTGCCCCAGGCCGGGGCTGG + Intronic
1077487643 11:2846386-2846408 CAGGTACCCACGGTGGGGGAGGG + Intronic
1078196263 11:9139393-9139415 CATGTGGCCACGGCGAGGGAGGG + Exonic
1079353720 11:19713771-19713793 CACGTGCCCCCGGCCCGGGCGGG + Exonic
1081794611 11:45810892-45810914 AAGGTGCTCCCGGCGGTGGACGG + Exonic
1081831465 11:46119878-46119900 CCCGCGCCCCCGCCGGGGGGAGG - Intronic
1083724879 11:64622898-64622920 CACCTGCGCCTGGTGGGGGAGGG - Exonic
1083886212 11:65574581-65574603 CAAGGGGCCCCGGCGGGGGCGGG + Intergenic
1084301531 11:68255619-68255641 CACGTGCCCACGGCAGGAGCCGG - Intergenic
1084310300 11:68312790-68312812 CACCTACCCGCGGCGGGGGCCGG - Exonic
1090013130 11:123062442-123062464 CAGTTACCCCGGGCGGGGGAGGG + Intronic
1093793755 12:23286206-23286228 CAGGAGCCCACGGCGGGGGCGGG - Intergenic
1096122062 12:49094675-49094697 CACGTGCCCCGGGAGCGGGCGGG + Exonic
1096156830 12:49345733-49345755 CGGGTCTCCCCGGCGGGGGATGG - Intergenic
1097863943 12:64543532-64543554 CAGGAGCCCACGGCGGGGGGCGG - Intergenic
1101351066 12:103930354-103930376 CACTTCCCGCGGGCGGGGGACGG - Exonic
1105324418 13:19356845-19356867 CACTTGAACCTGGCGGGGGATGG - Intergenic
1113768242 13:112894096-112894118 GCCGTGCCCGAGGCGGGGGAGGG - Intergenic
1114270667 14:21098309-21098331 CACGAGCCCCGGGCGGGCGGCGG + Exonic
1117881426 14:60316773-60316795 CAAGTTCCCCTGGCAGGGGAGGG - Intergenic
1123060694 14:105592863-105592885 CACGTCCCCCTGGCGAGGGCCGG - Intergenic
1123085169 14:105713834-105713856 CACGTCCCCCTGGCGAGGGCCGG - Intergenic
1123675619 15:22708445-22708467 CACGTGACCCCAGGTGGGGATGG - Intergenic
1123735367 15:23178513-23178535 CACGTGACCCCAGGTGGGGATGG + Intergenic
1124121475 15:26892444-26892466 CATGTGCGCGCGGCCGGGGAAGG - Intronic
1124285873 15:28399812-28399834 CACGTGACCCCAGGTGGGGATGG + Intergenic
1124296829 15:28511852-28511874 CACGTGACCCCAGGTGGGGATGG - Intergenic
1132519984 16:382389-382411 CACGCGCGCCGGGCGGGGCAGGG - Intronic
1133692576 16:8230772-8230794 CACGTGTCCCCAGAGGGGAAAGG + Intergenic
1142060752 16:88027678-88027700 CAGCTGCCCCGAGCGGGGGAGGG - Intronic
1143135239 17:4709174-4709196 CAGGAGCCCACGGAGGGGGAGGG + Intergenic
1143584422 17:7844177-7844199 CGCGTGGCCCCGGCGGGGAAGGG + Intronic
1144128118 17:12221142-12221164 CAGGAGCCCACGGCGGGGGGCGG - Intergenic
1145911915 17:28548007-28548029 CACCTGCCTCAGGCGGAGGAAGG + Exonic
1145999612 17:29123285-29123307 CCCGTGCCCCGGGTGGGGGATGG + Intronic
1147702021 17:42402320-42402342 CACGTGCCTGGGGTGGGGGAAGG - Intergenic
1147964869 17:44189216-44189238 CACATGCCCCAGGTGGAGGACGG - Exonic
1151728165 17:75896414-75896436 CTCGGGCACCCGGCGGGGGCGGG - Intronic
1151866465 17:76806394-76806416 CAGGAGCCCACGGCGGGGGCGGG - Intergenic
1152357294 17:79813390-79813412 CACGCTGCCCCGGCGGGGGCGGG - Intergenic
1152431933 17:80253077-80253099 CCAGTGCCACCTGCGGGGGAGGG + Exonic
1152627661 17:81395356-81395378 CACGAGCTCCCGGCCGTGGAGGG + Intergenic
1156250148 18:35344519-35344541 GAAGCGCCCCGGGCGGGGGAGGG + Intronic
1158553916 18:58459655-58459677 CAGGAGCCCACGGCGGGGGCAGG - Intergenic
1160330212 18:77984374-77984396 CAAGTGCTCCGGGCGGGGGAGGG - Intergenic
1160947973 19:1652280-1652302 CAGGTGAGCCCGGCGGGGGGCGG - Exonic
1161079269 19:2302557-2302579 GACGTGCCCCTTGCTGGGGAGGG - Intronic
1161170573 19:2810554-2810576 CATGTGCCCCGGGTGGGGGTCGG + Intronic
1161281716 19:3449148-3449170 CACGGGCCCCTGGCGGGGAGGGG + Intronic
1161560386 19:4969501-4969523 CGCGCGCCCCCGGCCCGGGAAGG - Intronic
1162473352 19:10885571-10885593 CACATGCCCCCTGCCCGGGATGG - Intronic
1164862197 19:31570541-31570563 CACATGCCCCTGGCGGGAGGTGG + Intergenic
1166218465 19:41351493-41351515 CCCATGCCCCCGGCGGAGGCGGG - Intronic
1167040162 19:47019273-47019295 CCCGTCCCTGCGGCGGGGGATGG + Intergenic
925942981 2:8837621-8837643 CACGTGCCCTGGGTAGGGGAGGG + Exonic
927927529 2:27024300-27024322 AACGTGCCCGAGCCGGGGGAGGG + Intronic
932288146 2:70553874-70553896 GGCCTGCCCCCGGCGCGGGAGGG + Exonic
932316934 2:70790690-70790712 CACGAGGCCCGGGCGGGGGCGGG + Intergenic
935196364 2:100819304-100819326 CACGTGCCCCTGCCGGGGAGGGG + Intergenic
937309498 2:120893339-120893361 CACATACCCCAGGTGGGGGAGGG - Intronic
938537020 2:132255921-132255943 CCCGACCCCCCGGCCGGGGACGG + Intronic
942565962 2:177264801-177264823 CCCGCGCGGCCGGCGGGGGAAGG - Exonic
943703633 2:191012999-191013021 CCAGAGTCCCCGGCGGGGGAAGG + Intronic
944114279 2:196171065-196171087 CACGCGCCCCGGGCTGAGGAGGG + Intronic
946692609 2:222320251-222320273 CACGCGCCGGGGGCGGGGGACGG - Intergenic
947610028 2:231518980-231519002 CACCTGCCCCAGCCGAGGGAAGG - Intergenic
947792428 2:232876021-232876043 CACGGGCTCCCGGCCGGGGCTGG - Exonic
947937991 2:234024361-234024383 CAGGAGCCCACGGCGGGCGAGGG + Intergenic
948125848 2:235564382-235564404 CAGGTGCCTTCGGTGGGGGAAGG + Intronic
1172230573 20:33333149-33333171 CACGTGGCCCTGGCAGGGCAGGG + Intergenic
1172484596 20:35290827-35290849 CCTGTGCCCCAGGCAGGGGACGG - Intronic
1176061581 20:63175076-63175098 CAGGTGGCTCCGGCGGGGGCGGG - Intergenic
1179488658 21:41726819-41726841 CACGACGCCCCGGCAGGGGAGGG - Intergenic
1179955453 21:44735757-44735779 CCCGTGACCCCGTTGGGGGATGG - Intergenic
1180190723 21:46161286-46161308 CGCGTCCCCCCGGAGGGGAAAGG - Exonic
1180729820 22:17972975-17972997 CACGTGGGCCCGGCTGGGCAAGG - Intronic
1181509327 22:23381984-23382006 CACGTGCCCCCGGCGGGGGATGG + Intergenic
1183504690 22:38202501-38202523 CGCGTCCGCCCGGCGGGGGCGGG + Intronic
1183618262 22:38957919-38957941 CACCTGCCCCGGGAGGTGGAAGG - Intronic
1183903476 22:41022636-41022658 CACGTGCCCGCGGTGGGGGCAGG + Intergenic
1183931326 22:41237719-41237741 CAGGTGGCCCAGGCCGGGGAAGG + Exonic
1184744540 22:46448476-46448498 AACGTGCCCCAGGAGGGGAAGGG + Intronic
952241321 3:31533329-31533351 CGCGGGCCACGGGCGGGGGAGGG - Intronic
954222963 3:49165903-49165925 CACGTGCCCCCGGGGAAGGCAGG + Intronic
956183909 3:66544741-66544763 CAGGAGCCCACAGCGGGGGAAGG + Intergenic
961465018 3:127076366-127076388 CAGGAGCCCACGGCGGGGCAGGG + Intergenic
962575487 3:136752030-136752052 CGCGGGCCCCGTGCGGGGGAGGG - Intronic
962827434 3:139110262-139110284 CACCTGCCCCCGGCGCAGGAAGG + Intronic
964117941 3:153155830-153155852 CACGAGCCCACGGAGGGGGTGGG + Intergenic
964801709 3:160565299-160565321 CGCGGGGCCCGGGCGGGGGAAGG - Exonic
968603668 4:1521488-1521510 CACGGGGCCCCGGCGGGGGCGGG - Intergenic
968756094 4:2417378-2417400 CACGAGCCCCAGGCGGGCGGCGG + Intronic
972344679 4:38182849-38182871 CAGGACCCCACGGCGGGGGATGG - Intergenic
972392590 4:38627182-38627204 CAGGTGCCCACGGAGGGGGTGGG - Intergenic
975582680 4:75921012-75921034 CACGTCCCCCCGGGAGGGGGTGG - Exonic
977942032 4:102869222-102869244 CACGTTCGCCAAGCGGGGGAAGG + Intronic
982245226 4:153344536-153344558 TCCGAGCCGCCGGCGGGGGAAGG - Intergenic
982712175 4:158768862-158768884 CACGTAACCCCGGCGGGAGGCGG - Intergenic
985652118 5:1112094-1112116 CACGTGGCCCGGGCGGGGCGGGG - Intergenic
985801435 5:2007504-2007526 GACTTGCCCCCGGAGCGGGATGG - Intergenic
986912508 5:12574595-12574617 CAGGAGCCCACGGCGGGGGCGGG + Intergenic
992484375 5:77180846-77180868 CACGCTTCCCCGGCGCGGGACGG + Intergenic
995678941 5:114695722-114695744 CAGGAGCCCACGGCAGGGGAGGG - Intergenic
996329337 5:122312011-122312033 CGCGGGCGCCCGGCCGGGGACGG - Intronic
1002416210 5:179122130-179122152 CACCTGCCCCCAGCTGGGGAGGG - Intronic
1002571609 5:180142892-180142914 CACGTGCCCCCGCTGTGGCAAGG + Intronic
1002598483 5:180339726-180339748 CACCTGCCCAGGGCGGGGGCTGG - Intronic
1003325100 6:5085212-5085234 AACCTGCCCGCGACGGGGGAGGG - Exonic
1004250346 6:14018276-14018298 CAGGAGCCCACGGCGGGGGGTGG - Intergenic
1006338224 6:33431932-33431954 CAGGAGCCCCCTGAGGGGGATGG - Intronic
1006378751 6:33685697-33685719 CTCGTGCCCCCGGCGCAGGCTGG - Exonic
1006472702 6:34237450-34237472 CGCGAGCCGGCGGCGGGGGAGGG + Intronic
1017103120 6:150865811-150865833 CGCGTGCCCATGGCGCGGGACGG - Exonic
1019925814 7:4191242-4191264 CATGTGACCGCGGCGGGGGAGGG - Intronic
1022112423 7:27239749-27239771 CCCGTCGCCCCAGCGGGGGAAGG + Intergenic
1022790144 7:33680267-33680289 CACCTACCTCCGGTGGGGGAAGG + Intergenic
1023872219 7:44269327-44269349 CCAGTGCCCCCCGCGGGGGAAGG + Intronic
1024323207 7:48089471-48089493 CACGTGGCCAAGGCAGGGGACGG - Intronic
1026535668 7:71236722-71236744 CAGGTGCCCCCGCCGAGGGCTGG - Intronic
1034203130 7:149294720-149294742 CACGTGCGCCCGACGGTGGCTGG - Intronic
1034977944 7:155458778-155458800 CATGTGCGCCCGGCGCGGGCGGG + Exonic
1041068569 8:54104475-54104497 CAGGAGCCCACGGCGGGGGCGGG - Intergenic
1047100157 8:121667526-121667548 CAGGAGCCCCCGGCGGGGGCGGG + Intergenic
1189324841 X:40105983-40106005 CTCTAGCCTCCGGCGGGGGACGG + Intronic
1192839136 X:74836062-74836084 CACTTGCCCATGGTGGGGGAAGG + Intronic
1195168910 X:102247007-102247029 CCCGAGCCCCAGGAGGGGGAGGG + Intergenic
1195189947 X:102440079-102440101 CCCGAGCCCCAGGAGGGGGAGGG - Intronic
1195853906 X:109310236-109310258 CATGTGCCCCAGCCGGGGGTAGG + Intergenic
1197980881 X:132217566-132217588 CGCGTGCCCCCGGGAGGGAAAGG + Exonic
1200003754 X:153074510-153074532 CACGTGCCCCTGGCACTGGAGGG - Exonic
1200097973 X:153673113-153673135 CCCTTGCCCCCGGCGGGGCGGGG - Intronic
1200209582 X:154341386-154341408 CACGGGCCCCCGCCAGGGGCTGG + Intergenic
1200221294 X:154390742-154390764 CACGGGCCCCCGCCAGGGGCTGG - Intronic