ID: 1181510778

View in Genome Browser
Species Human (GRCh38)
Location 22:23387912-23387934
Sequence CTGGAGCCGGGCTGCAGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181510778_1181510787 5 Left 1181510778 22:23387912-23387934 CCTGCGCTGCAGCCCGGCTCCAG No data
Right 1181510787 22:23387940-23387962 AGGACTCGGGTCTCCATGCTGGG No data
1181510778_1181510786 4 Left 1181510778 22:23387912-23387934 CCTGCGCTGCAGCCCGGCTCCAG No data
Right 1181510786 22:23387939-23387961 AAGGACTCGGGTCTCCATGCTGG No data
1181510778_1181510784 -8 Left 1181510778 22:23387912-23387934 CCTGCGCTGCAGCCCGGCTCCAG No data
Right 1181510784 22:23387927-23387949 GGCTCCAGCAGGAAGGACTCGGG No data
1181510778_1181510783 -9 Left 1181510778 22:23387912-23387934 CCTGCGCTGCAGCCCGGCTCCAG No data
Right 1181510783 22:23387926-23387948 CGGCTCCAGCAGGAAGGACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181510778 Original CRISPR CTGGAGCCGGGCTGCAGCGC AGG (reversed) Intergenic
No off target data available for this crispr