ID: 1181512361

View in Genome Browser
Species Human (GRCh38)
Location 22:23394630-23394652
Sequence GCTGCTGCTGGGCACCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181512347_1181512361 21 Left 1181512347 22:23394586-23394608 CCCCTGGCCCTGACTGCCACCGC No data
Right 1181512361 22:23394630-23394652 GCTGCTGCTGGGCACCCTGCTGG No data
1181512354_1181512361 2 Left 1181512354 22:23394605-23394627 CCGCCCGTAGGCTGCTGATCCTG No data
Right 1181512361 22:23394630-23394652 GCTGCTGCTGGGCACCCTGCTGG No data
1181512348_1181512361 20 Left 1181512348 22:23394587-23394609 CCCTGGCCCTGACTGCCACCGCC No data
Right 1181512361 22:23394630-23394652 GCTGCTGCTGGGCACCCTGCTGG No data
1181512345_1181512361 30 Left 1181512345 22:23394577-23394599 CCCTGCGTGCCCCTGGCCCTGAC No data
Right 1181512361 22:23394630-23394652 GCTGCTGCTGGGCACCCTGCTGG No data
1181512353_1181512361 5 Left 1181512353 22:23394602-23394624 CCACCGCCCGTAGGCTGCTGATC No data
Right 1181512361 22:23394630-23394652 GCTGCTGCTGGGCACCCTGCTGG No data
1181512346_1181512361 29 Left 1181512346 22:23394578-23394600 CCTGCGTGCCCCTGGCCCTGACT No data
Right 1181512361 22:23394630-23394652 GCTGCTGCTGGGCACCCTGCTGG No data
1181512350_1181512361 14 Left 1181512350 22:23394593-23394615 CCCTGACTGCCACCGCCCGTAGG No data
Right 1181512361 22:23394630-23394652 GCTGCTGCTGGGCACCCTGCTGG No data
1181512357_1181512361 -2 Left 1181512357 22:23394609-23394631 CCGTAGGCTGCTGATCCTGAGGC No data
Right 1181512361 22:23394630-23394652 GCTGCTGCTGGGCACCCTGCTGG No data
1181512349_1181512361 19 Left 1181512349 22:23394588-23394610 CCTGGCCCTGACTGCCACCGCCC No data
Right 1181512361 22:23394630-23394652 GCTGCTGCTGGGCACCCTGCTGG No data
1181512355_1181512361 -1 Left 1181512355 22:23394608-23394630 CCCGTAGGCTGCTGATCCTGAGG No data
Right 1181512361 22:23394630-23394652 GCTGCTGCTGGGCACCCTGCTGG No data
1181512352_1181512361 13 Left 1181512352 22:23394594-23394616 CCTGACTGCCACCGCCCGTAGGC No data
Right 1181512361 22:23394630-23394652 GCTGCTGCTGGGCACCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181512361 Original CRISPR GCTGCTGCTGGGCACCCTGC TGG Intergenic
No off target data available for this crispr