ID: 1181513169

View in Genome Browser
Species Human (GRCh38)
Location 22:23397824-23397846
Sequence GACCCAAGGCCACCCCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181513169_1181513179 6 Left 1181513169 22:23397824-23397846 CCAGGCTGGGGTGGCCTTGGGTC No data
Right 1181513179 22:23397853-23397875 GCAGAGAAGTTGATGGGGAACGG No data
1181513169_1181513180 7 Left 1181513169 22:23397824-23397846 CCAGGCTGGGGTGGCCTTGGGTC No data
Right 1181513180 22:23397854-23397876 CAGAGAAGTTGATGGGGAACGGG No data
1181513169_1181513183 19 Left 1181513169 22:23397824-23397846 CCAGGCTGGGGTGGCCTTGGGTC No data
Right 1181513183 22:23397866-23397888 TGGGGAACGGGGGTGTGCTGCGG No data
1181513169_1181513178 1 Left 1181513169 22:23397824-23397846 CCAGGCTGGGGTGGCCTTGGGTC No data
Right 1181513178 22:23397848-23397870 CTGGGGCAGAGAAGTTGATGGGG No data
1181513169_1181513184 20 Left 1181513169 22:23397824-23397846 CCAGGCTGGGGTGGCCTTGGGTC No data
Right 1181513184 22:23397867-23397889 GGGGAACGGGGGTGTGCTGCGGG No data
1181513169_1181513175 -1 Left 1181513169 22:23397824-23397846 CCAGGCTGGGGTGGCCTTGGGTC No data
Right 1181513175 22:23397846-23397868 CCCTGGGGCAGAGAAGTTGATGG No data
1181513169_1181513182 9 Left 1181513169 22:23397824-23397846 CCAGGCTGGGGTGGCCTTGGGTC No data
Right 1181513182 22:23397856-23397878 GAGAAGTTGATGGGGAACGGGGG No data
1181513169_1181513177 0 Left 1181513169 22:23397824-23397846 CCAGGCTGGGGTGGCCTTGGGTC No data
Right 1181513177 22:23397847-23397869 CCTGGGGCAGAGAAGTTGATGGG No data
1181513169_1181513181 8 Left 1181513169 22:23397824-23397846 CCAGGCTGGGGTGGCCTTGGGTC No data
Right 1181513181 22:23397855-23397877 AGAGAAGTTGATGGGGAACGGGG No data
1181513169_1181513186 27 Left 1181513169 22:23397824-23397846 CCAGGCTGGGGTGGCCTTGGGTC No data
Right 1181513186 22:23397874-23397896 GGGGGTGTGCTGCGGGGTCCTGG No data
1181513169_1181513185 21 Left 1181513169 22:23397824-23397846 CCAGGCTGGGGTGGCCTTGGGTC No data
Right 1181513185 22:23397868-23397890 GGGAACGGGGGTGTGCTGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181513169 Original CRISPR GACCCAAGGCCACCCCAGCC TGG (reversed) Intergenic
No off target data available for this crispr