ID: 1181513888

View in Genome Browser
Species Human (GRCh38)
Location 22:23400852-23400874
Sequence CAGGGCAACCACAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181513873_1181513888 23 Left 1181513873 22:23400806-23400828 CCAGGGCTCAGCCTTTTGAGCTA No data
Right 1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG No data
1181513872_1181513888 24 Left 1181513872 22:23400805-23400827 CCCAGGGCTCAGCCTTTTGAGCT No data
Right 1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG No data
1181513880_1181513888 -6 Left 1181513880 22:23400835-23400857 CCCAGGGGCCTACCACTCAGGGC No data
Right 1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG No data
1181513881_1181513888 -7 Left 1181513881 22:23400836-23400858 CCAGGGGCCTACCACTCAGGGCA No data
Right 1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG No data
1181513874_1181513888 12 Left 1181513874 22:23400817-23400839 CCTTTTGAGCTACGCAGTCCCAG No data
Right 1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181513888 Original CRISPR CAGGGCAACCACAGGGAGGA GGG Intergenic
No off target data available for this crispr