ID: 1181518340

View in Genome Browser
Species Human (GRCh38)
Location 22:23430891-23430913
Sequence GCTTCCTGGCAGTCACACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181518340_1181518347 1 Left 1181518340 22:23430891-23430913 CCAGGGTGTGACTGCCAGGAAGC No data
Right 1181518347 22:23430915-23430937 GGGTCGCTCAGGGCCATCCTGGG No data
1181518340_1181518345 -9 Left 1181518340 22:23430891-23430913 CCAGGGTGTGACTGCCAGGAAGC No data
Right 1181518345 22:23430905-23430927 CCAGGAAGCAGGGTCGCTCAGGG No data
1181518340_1181518343 -10 Left 1181518340 22:23430891-23430913 CCAGGGTGTGACTGCCAGGAAGC No data
Right 1181518343 22:23430904-23430926 GCCAGGAAGCAGGGTCGCTCAGG No data
1181518340_1181518346 0 Left 1181518340 22:23430891-23430913 CCAGGGTGTGACTGCCAGGAAGC No data
Right 1181518346 22:23430914-23430936 AGGGTCGCTCAGGGCCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181518340 Original CRISPR GCTTCCTGGCAGTCACACCC TGG (reversed) Intergenic
No off target data available for this crispr