ID: 1181523040

View in Genome Browser
Species Human (GRCh38)
Location 22:23460232-23460254
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181523040_1181523059 20 Left 1181523040 22:23460232-23460254 CCCCTGTCCAGGTCCTCAGACTG No data
Right 1181523059 22:23460275-23460297 AGGAGCTGTGTAGGGAGGGAGGG No data
1181523040_1181523058 19 Left 1181523040 22:23460232-23460254 CCCCTGTCCAGGTCCTCAGACTG No data
Right 1181523058 22:23460274-23460296 GAGGAGCTGTGTAGGGAGGGAGG No data
1181523040_1181523061 26 Left 1181523040 22:23460232-23460254 CCCCTGTCCAGGTCCTCAGACTG No data
Right 1181523061 22:23460281-23460303 TGTGTAGGGAGGGAGGGGAGAGG No data
1181523040_1181523048 -3 Left 1181523040 22:23460232-23460254 CCCCTGTCCAGGTCCTCAGACTG No data
Right 1181523048 22:23460252-23460274 CTGAGGGAAGCCCCCATGGCTGG No data
1181523040_1181523060 21 Left 1181523040 22:23460232-23460254 CCCCTGTCCAGGTCCTCAGACTG No data
Right 1181523060 22:23460276-23460298 GGAGCTGTGTAGGGAGGGAGGGG No data
1181523040_1181523055 12 Left 1181523040 22:23460232-23460254 CCCCTGTCCAGGTCCTCAGACTG No data
Right 1181523055 22:23460267-23460289 ATGGCTGGAGGAGCTGTGTAGGG No data
1181523040_1181523047 -7 Left 1181523040 22:23460232-23460254 CCCCTGTCCAGGTCCTCAGACTG No data
Right 1181523047 22:23460248-23460270 CAGACTGAGGGAAGCCCCCATGG No data
1181523040_1181523056 15 Left 1181523040 22:23460232-23460254 CCCCTGTCCAGGTCCTCAGACTG No data
Right 1181523056 22:23460270-23460292 GCTGGAGGAGCTGTGTAGGGAGG No data
1181523040_1181523057 16 Left 1181523040 22:23460232-23460254 CCCCTGTCCAGGTCCTCAGACTG No data
Right 1181523057 22:23460271-23460293 CTGGAGGAGCTGTGTAGGGAGGG No data
1181523040_1181523054 11 Left 1181523040 22:23460232-23460254 CCCCTGTCCAGGTCCTCAGACTG No data
Right 1181523054 22:23460266-23460288 CATGGCTGGAGGAGCTGTGTAGG No data
1181523040_1181523062 27 Left 1181523040 22:23460232-23460254 CCCCTGTCCAGGTCCTCAGACTG No data
Right 1181523062 22:23460282-23460304 GTGTAGGGAGGGAGGGGAGAGGG No data
1181523040_1181523049 0 Left 1181523040 22:23460232-23460254 CCCCTGTCCAGGTCCTCAGACTG No data
Right 1181523049 22:23460255-23460277 AGGGAAGCCCCCATGGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181523040 Original CRISPR CAGTCTGAGGACCTGGACAG GGG (reversed) Intergenic
No off target data available for this crispr