ID: 1181523047

View in Genome Browser
Species Human (GRCh38)
Location 22:23460248-23460270
Sequence CAGACTGAGGGAAGCCCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181523041_1181523047 -8 Left 1181523041 22:23460233-23460255 CCCTGTCCAGGTCCTCAGACTGA No data
Right 1181523047 22:23460248-23460270 CAGACTGAGGGAAGCCCCCATGG No data
1181523036_1181523047 30 Left 1181523036 22:23460195-23460217 CCTGGAATAAGGCCTGGCAGGGT No data
Right 1181523047 22:23460248-23460270 CAGACTGAGGGAAGCCCCCATGG No data
1181523042_1181523047 -9 Left 1181523042 22:23460234-23460256 CCTGTCCAGGTCCTCAGACTGAG No data
Right 1181523047 22:23460248-23460270 CAGACTGAGGGAAGCCCCCATGG No data
1181523040_1181523047 -7 Left 1181523040 22:23460232-23460254 CCCCTGTCCAGGTCCTCAGACTG No data
Right 1181523047 22:23460248-23460270 CAGACTGAGGGAAGCCCCCATGG No data
1181523038_1181523047 18 Left 1181523038 22:23460207-23460229 CCTGGCAGGGTTGAGGACGCATC No data
Right 1181523047 22:23460248-23460270 CAGACTGAGGGAAGCCCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181523047 Original CRISPR CAGACTGAGGGAAGCCCCCA TGG Intergenic
No off target data available for this crispr