ID: 1181523049

View in Genome Browser
Species Human (GRCh38)
Location 22:23460255-23460277
Sequence AGGGAAGCCCCCATGGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181523045_1181523049 -7 Left 1181523045 22:23460239-23460261 CCAGGTCCTCAGACTGAGGGAAG No data
Right 1181523049 22:23460255-23460277 AGGGAAGCCCCCATGGCTGGAGG No data
1181523041_1181523049 -1 Left 1181523041 22:23460233-23460255 CCCTGTCCAGGTCCTCAGACTGA No data
Right 1181523049 22:23460255-23460277 AGGGAAGCCCCCATGGCTGGAGG No data
1181523038_1181523049 25 Left 1181523038 22:23460207-23460229 CCTGGCAGGGTTGAGGACGCATC No data
Right 1181523049 22:23460255-23460277 AGGGAAGCCCCCATGGCTGGAGG No data
1181523042_1181523049 -2 Left 1181523042 22:23460234-23460256 CCTGTCCAGGTCCTCAGACTGAG No data
Right 1181523049 22:23460255-23460277 AGGGAAGCCCCCATGGCTGGAGG No data
1181523040_1181523049 0 Left 1181523040 22:23460232-23460254 CCCCTGTCCAGGTCCTCAGACTG No data
Right 1181523049 22:23460255-23460277 AGGGAAGCCCCCATGGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181523049 Original CRISPR AGGGAAGCCCCCATGGCTGG AGG Intergenic
No off target data available for this crispr