ID: 1181523060

View in Genome Browser
Species Human (GRCh38)
Location 22:23460276-23460298
Sequence GGAGCTGTGTAGGGAGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181523051_1181523060 -10 Left 1181523051 22:23460263-23460285 CCCCATGGCTGGAGGAGCTGTGT No data
Right 1181523060 22:23460276-23460298 GGAGCTGTGTAGGGAGGGAGGGG No data
1181523041_1181523060 20 Left 1181523041 22:23460233-23460255 CCCTGTCCAGGTCCTCAGACTGA No data
Right 1181523060 22:23460276-23460298 GGAGCTGTGTAGGGAGGGAGGGG No data
1181523046_1181523060 8 Left 1181523046 22:23460245-23460267 CCTCAGACTGAGGGAAGCCCCCA No data
Right 1181523060 22:23460276-23460298 GGAGCTGTGTAGGGAGGGAGGGG No data
1181523042_1181523060 19 Left 1181523042 22:23460234-23460256 CCTGTCCAGGTCCTCAGACTGAG No data
Right 1181523060 22:23460276-23460298 GGAGCTGTGTAGGGAGGGAGGGG No data
1181523050_1181523060 -9 Left 1181523050 22:23460262-23460284 CCCCCATGGCTGGAGGAGCTGTG No data
Right 1181523060 22:23460276-23460298 GGAGCTGTGTAGGGAGGGAGGGG No data
1181523045_1181523060 14 Left 1181523045 22:23460239-23460261 CCAGGTCCTCAGACTGAGGGAAG No data
Right 1181523060 22:23460276-23460298 GGAGCTGTGTAGGGAGGGAGGGG No data
1181523040_1181523060 21 Left 1181523040 22:23460232-23460254 CCCCTGTCCAGGTCCTCAGACTG No data
Right 1181523060 22:23460276-23460298 GGAGCTGTGTAGGGAGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181523060 Original CRISPR GGAGCTGTGTAGGGAGGGAG GGG Intergenic
No off target data available for this crispr