ID: 1181524329

View in Genome Browser
Species Human (GRCh38)
Location 22:23470807-23470829
Sequence CTGTAAAAAAGATGCTACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 202}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181524329 Original CRISPR CTGTAAAAAAGATGCTACCA AGG (reversed) Intergenic
907176442 1:52527757-52527779 CTGTAATAAACATGCTACTCTGG + Intronic
909917485 1:81337761-81337783 CTGAAAAAAAGAGTCTGCCAGGG - Intronic
910314320 1:85865218-85865240 GTGTCACAAAGATGCTACCTTGG - Intronic
911944602 1:104091212-104091234 CTGTAATAAAGATGATGGCATGG + Intergenic
912432229 1:109634765-109634787 CAGTAAAAAAAATTCTACCTTGG - Intergenic
915959821 1:160256329-160256351 ATGAAAAAATGATGCTCCCAAGG + Intronic
918174541 1:182031319-182031341 CGGTATAAAAAATGCCACCAAGG - Intergenic
921419841 1:214933704-214933726 CTGTAAGAATGATGTTAGCATGG + Intergenic
923829014 1:237533617-237533639 GTGTAAAAAACATTCTACAAGGG + Intronic
924288633 1:242514004-242514026 CACTAAAAAAGATGCTACACTGG + Intronic
924450378 1:244173515-244173537 CTTGAAAAAAGAAACTACCAGGG + Intergenic
924554102 1:245103903-245103925 CTGTAAACAAGATCCTAAGAAGG + Intronic
1063470952 10:6284759-6284781 ATGTAACATAGAGGCTACCAGGG - Intergenic
1063933860 10:11057085-11057107 CTGTTACACAGATGGTACCAGGG - Intronic
1064502413 10:15988717-15988739 CTGTAATCAAGATGCTAGCAGGG + Intergenic
1065169433 10:23011668-23011690 CTGTAAAAAAAAAGCAAGCAAGG - Intronic
1066011738 10:31200753-31200775 CTGTAATAAAGATGTTGACATGG - Intergenic
1067519263 10:46983624-46983646 GTGGCAAAAGGATGCTACCAAGG - Intronic
1067642982 10:48068215-48068237 GTGGCAAAAGGATGCTACCAAGG + Intergenic
1067670105 10:48312301-48312323 CAGTAGAAAAGATGCTACTCAGG + Intronic
1068588324 10:58826422-58826444 CTGGAAAAAAAATGCCACAAAGG + Intronic
1069269532 10:66508003-66508025 ATTTAAAAAAAATGCTAACAAGG - Intronic
1070008824 10:72452416-72452438 CACTAAAAATGATGCCACCATGG + Intronic
1070978482 10:80624990-80625012 CTGTTAAAAAGAGGTTACAATGG - Intronic
1072261771 10:93683152-93683174 CTGTAAAAATGAGGCTACTCAGG - Intronic
1073482645 10:103796628-103796650 CTGTACAAAAGCTGCTGCCTGGG + Intronic
1074409697 10:113216306-113216328 CTGGAAAAAAGAAGCAACAATGG - Intergenic
1074759782 10:116658473-116658495 CTGAAAATAAGAGGCTGCCAAGG + Intergenic
1075595680 10:123727460-123727482 ATGTACAGAAGATGATACCATGG - Intronic
1076641802 10:131921815-131921837 CTGTAAATCAGAGTCTACCATGG + Intronic
1077853529 11:6098503-6098525 CTGGAAAAAAGATATCACCAAGG + Intergenic
1081046538 11:38280421-38280443 ATGTAAAATATATGCTCCCAGGG + Intergenic
1088577189 11:111283720-111283742 TTGTGAAAAAGATGCTTCCTTGG + Intronic
1090679824 11:129043015-129043037 CTGTAAAAAGGTGGTTACCAAGG + Intronic
1097492844 12:60291711-60291733 CTGCTATAAAGATACTACCAGGG - Intergenic
1098500967 12:71191187-71191209 CTGTTAAAAAGATGATTCTATGG - Intronic
1099038730 12:77623318-77623340 CTCTAATCAAGATGCTCCCATGG - Intergenic
1099299003 12:80868104-80868126 CAGTAAAAGAAGTGCTACCAAGG - Intronic
1099339200 12:81406893-81406915 CTGAAAAAAACATGATATCAAGG + Intronic
1099456371 12:82867646-82867668 CTGAAAAAAAGATTATACCAAGG + Intronic
1100446725 12:94667810-94667832 CTATACATAAGATGCTACCAGGG - Intergenic
1101063719 12:100997846-100997868 CTGTGATAAAGAGGTTACCAGGG - Intronic
1101221064 12:102641219-102641241 CTGTATAAATGTTGCTACAAAGG - Intergenic
1102832057 12:116011784-116011806 CTCTCAACAAGAGGCTACCAAGG + Intronic
1104302799 12:127581007-127581029 TTGGAAACAAGATGCTTCCATGG - Intergenic
1107356448 13:39572264-39572286 GTTTAAAAAATATACTACCACGG - Intronic
1107785641 13:43954335-43954357 CTGAAAAGAACATGCTAACAAGG - Intergenic
1110360994 13:74625373-74625395 CTTTAAAAAAAAAGCTAACATGG - Intergenic
1110563208 13:76931341-76931363 CTGGAAAAAAAATGCCACAAAGG - Intergenic
1110868688 13:80424955-80424977 CTTAAAAAAAAATGGTACCAAGG - Intergenic
1113159061 13:107358586-107358608 CTTTAAAAAACATGCTTCCCAGG - Intronic
1114207584 14:20587509-20587531 CCCAAAAAATGATGCTACCAAGG + Intronic
1114792005 14:25669813-25669835 CTGATAAAGAGATGCAACCAAGG - Intergenic
1118994972 14:70827350-70827372 CTGTAAACAATATCCCACCAAGG + Intergenic
1120644999 14:87063588-87063610 AAGTAAAAGAGATGCTAACATGG - Intergenic
1121984441 14:98489574-98489596 CTGTAAAAAAGAAGAAACTACGG + Intergenic
1123782502 15:23642404-23642426 CTTGAAAACAGATGCTACCTTGG + Intergenic
1124400046 15:29340120-29340142 CTGTCAATTAGATGCAACCATGG + Intronic
1128659339 15:69486593-69486615 CTGTAAAAATGAAGACACCAAGG - Intergenic
1129036348 15:72651450-72651472 CTTTTAAAAAGATGATGCCAAGG - Intergenic
1129213539 15:74085775-74085797 CTTTTAAAAAGATGATGCCAAGG + Intergenic
1129396861 15:75255310-75255332 CTTTTAAAAAGATGATGCCAAGG - Intergenic
1129400473 15:75279588-75279610 CTTTTAAAAAGATGATGCCAAGG - Intronic
1130512206 15:84599234-84599256 GGATAATAAAGATGCTACCAGGG + Intergenic
1134152715 16:11817779-11817801 AAATAAAAAAGATGTTACCAAGG + Intergenic
1135109399 16:19678940-19678962 CTGTCAAAAAGGTGGTACAAGGG - Intronic
1135411491 16:22238320-22238342 CTCAAAATAAGATGCTAGCACGG - Intronic
1136082884 16:27864348-27864370 AGGTAAAAAGGATGCTATCAAGG + Intronic
1141460481 16:84176106-84176128 CTTTAAAAAAGAAGCTAAGAGGG + Exonic
1141676699 16:85521560-85521582 CTGTAAAGAAGAAGATACCGAGG - Intergenic
1144889537 17:18486465-18486487 CTGAAAAATAAATGTTACCAGGG - Intronic
1145142674 17:20457831-20457853 CTGAAAAATAAATGTTACCAGGG + Intronic
1147504705 17:41004284-41004306 TGGGAAAAAAAATGCTACCATGG - Intergenic
1147840456 17:43368038-43368060 CTGAAAAAAACATGCTACATTGG + Intergenic
1147923124 17:43930921-43930943 CTGTCAATCAGCTGCTACCAGGG + Intergenic
1149087300 17:52733489-52733511 CTGCTATAAAGATGCTACCTGGG + Intergenic
1149910779 17:60564952-60564974 CTGAAAAAAAGCTGTGACCAAGG - Intronic
1152674330 17:81630155-81630177 CTTTAAAAAAGATGTTACTTTGG + Intronic
1156702799 18:39844380-39844402 CTGTAAGAAAGAGTCTACTAGGG - Intergenic
1160123640 18:76151484-76151506 GTGTAAGAAAGATGCACCCATGG - Intergenic
1162549081 19:11348597-11348619 CTGGATAAAAGATGATCCCAAGG - Intronic
1163891416 19:20019318-20019340 CTGTAAAAAACATACTATGAAGG + Intronic
1166443705 19:42839687-42839709 CTGAGAAAAAGATGCAACCATGG - Intronic
1166466475 19:43036276-43036298 CTGAGAAAAAGATGCAACCATGG - Intronic
925283098 2:2698476-2698498 CTTAAAAACAGATGCTGCCACGG - Intergenic
926195589 2:10761867-10761889 CTGTAAAACAAATTCTCCCAAGG + Intronic
926934234 2:18071153-18071175 TTTTAAAAGAGATGCTTCCAAGG - Intronic
929161308 2:38835203-38835225 CTGGAAAAAAAATGCCACAAAGG + Intronic
929190424 2:39134762-39134784 CTGTAAAAAACATGAGACCCAGG + Intergenic
929336622 2:40755565-40755587 CTGTGAATAAGAAACTACCAAGG - Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
930548250 2:52797720-52797742 CTGCAACAAATATGCTATCATGG - Intergenic
932815905 2:74861542-74861564 CTTTAAAAATGAGGCAACCAAGG + Intronic
933110794 2:78397501-78397523 CAATAAAAAAAATGCAACCAAGG + Intergenic
933190651 2:79330011-79330033 CTGTAAAACAGCTTCTTCCATGG + Intronic
934919225 2:98329363-98329385 CTCAAAAAAAGATACTAACAAGG + Intergenic
936729473 2:115362952-115362974 CTGCACAAAAGAGGATACCAAGG - Intronic
937621461 2:123992501-123992523 CAGTCAAAAGGAGGCTACCAGGG + Intergenic
938793890 2:134702345-134702367 CTATTAAAAAGATCCAACCAGGG + Intronic
941677714 2:168361719-168361741 CTGAAAAAAAAATGCAAGCAGGG - Intergenic
941871600 2:170391424-170391446 CTGTACAAAAGATTATTCCATGG - Intronic
943231569 2:185259346-185259368 CTGAAATAAAGATGTTAACAAGG + Intergenic
945008532 2:205436716-205436738 CCGTAGAAAAGAAGCCACCAGGG - Intronic
946093231 2:217249184-217249206 TTGTAATAAATATGCTAACAGGG - Intergenic
1171393683 20:24817372-24817394 ATCTAAAAAAGATGCCAGCATGG - Intergenic
1172668285 20:36615685-36615707 CTGTCAAGAAGATGCTGGCAAGG + Intronic
1174026325 20:47579513-47579535 CTGGAAAAAAGATTCTGCAAAGG - Intronic
1174547950 20:51340393-51340415 CTGTAAAAAGGAGGCTAGGAGGG - Intergenic
1175697791 20:61115421-61115443 CATTAAAAAAAATGCTGCCATGG - Intergenic
1177493137 21:21854321-21854343 TTGTAAAAAGAATGCTACAAAGG + Intergenic
1177630366 21:23719371-23719393 CTGTAAATAATATGTAACCATGG + Intergenic
1177770821 21:25513682-25513704 CTGTAAAATAAATGATACCTAGG - Intergenic
1177861945 21:26464546-26464568 CTGTTACAAAGATCCTACCTGGG - Intergenic
1178309624 21:31518869-31518891 CTGTAAAAACAATGTTACCAGGG - Intronic
1179223914 21:39435510-39435532 CTGTCAAAAAAATACTACCGTGG - Exonic
1181524329 22:23470807-23470829 CTGTAAAAAAGATGCTACCAAGG - Intergenic
1183067859 22:35375902-35375924 CTGTAAAACAGATTCTACACAGG - Intergenic
1183856369 22:40637456-40637478 CTGCAAAAAAGAGGATTCCACGG + Intergenic
1184308603 22:43626640-43626662 CTTTAAAACAGATGCTGACAGGG - Exonic
949728604 3:7080079-7080101 CTATAAAAAAGATGCTAATGGGG - Intronic
949975320 3:9452107-9452129 CTAGAAGAAAGATGCTACCATGG - Intronic
950858713 3:16128662-16128684 CTGTAAACATGGTGCCACCATGG - Intergenic
952240575 3:31528041-31528063 CTGTAAAGATGAGGATACCAAGG + Intergenic
954884638 3:53861840-53861862 CTGGGAAAAAAATGCTACAAAGG + Intronic
955424534 3:58774179-58774201 CTTGAAAAAAAATGCTATCAAGG + Intronic
955579232 3:60401085-60401107 CTTTAAATCAGGTGCTACCAGGG - Intronic
955709880 3:61767476-61767498 CTGTAAAACATATTCTGCCAAGG - Intronic
955716326 3:61834125-61834147 CTGTAACAAACATCCTTCCAAGG - Intronic
957296172 3:78335637-78335659 CTGTAAAATATATTCTCCCAAGG + Intergenic
960782319 3:121333061-121333083 CTATAAAAAAAATGCTAAAAGGG + Intronic
961205535 3:125078445-125078467 GTTTGAAAAAGATGGTACCAAGG - Intergenic
962172940 3:133121907-133121929 CTGAAAAAAATATTATACCATGG + Intronic
963046323 3:141105111-141105133 CTGTGAAAAAGAGGCTAAAATGG - Intronic
964069719 3:152616839-152616861 CTGTAAAATAAATGCTCCAAAGG + Intergenic
967287452 3:187887146-187887168 CAGTAAGCAAGATGTTACCATGG - Intergenic
967485033 3:190020519-190020541 CCATAAAAAAGATGCTAGGAGGG - Intronic
970421960 4:15913317-15913339 CTGCAAACAAGATGTCACCAAGG - Intergenic
970706024 4:18804044-18804066 CTGTAAAAATGATGATTCCTAGG - Intergenic
972458833 4:39280260-39280282 GTGCATCAAAGATGCTACCAAGG - Intronic
973005042 4:44995401-44995423 CTGTAAAAGAGAGATTACCAGGG - Intergenic
975198444 4:71554797-71554819 ATGTAAACAAGATGCTTCTATGG - Intronic
977163605 4:93667764-93667786 CTGTGAAAAAGATGAGATCAAGG + Intronic
979926846 4:126578241-126578263 CTGCAAAAAAGATGCTGCCAAGG - Intergenic
980075372 4:128288074-128288096 CTGAAGAAAAGATGCTACGACGG + Exonic
981286347 4:143023682-143023704 AAGTAAAATAGAGGCTACCAAGG + Intergenic
982425542 4:155254282-155254304 CTGGAAAAAAAATGCCACAAAGG - Intergenic
982749102 4:159137572-159137594 CAGTATTAAAGATGCTACTATGG - Intronic
982876390 4:160656186-160656208 ATGTAATAAAGATGCTACAGAGG - Intergenic
984145083 4:176050620-176050642 CTGGAAAAAAGATGCATCAAAGG + Intergenic
986059527 5:4174955-4174977 CTTTAACAAAAATGCTTCCAAGG + Intergenic
986864054 5:11963571-11963593 CTTTAAAGAAGATGCTTCAAAGG + Intergenic
987026795 5:13935184-13935206 ATTTAAAAAAGATTCTTCCATGG + Intronic
990057454 5:51601517-51601539 CTATAAAAAAGTTGCTGGCATGG + Intergenic
991626960 5:68612619-68612641 ATGAAAAAAAGAAGCTGCCAGGG + Intergenic
992465236 5:76997832-76997854 GTGTAAAAAAGATGACACCCTGG - Intergenic
992598320 5:78368910-78368932 CTTTTAAAAATCTGCTACCATGG + Intronic
992857824 5:80881307-80881329 CCGTAACAAACATGCCACCACGG - Intergenic
992954081 5:81890070-81890092 CTGTTATAAAGATACTACCTGGG - Intergenic
993106678 5:83607979-83608001 CAGTAAGCAAGATGCTACTATGG + Intergenic
994601189 5:101907502-101907524 CTGGAAAAAAAATGCCACGAAGG + Intergenic
997225551 5:132207182-132207204 CAGTAACAAAGAAACTACCAAGG + Intronic
997308997 5:132864236-132864258 CTATAAGACATATGCTACCAAGG - Exonic
997327968 5:133037646-133037668 ATGTAAAATAGAGGTTACCAGGG - Intergenic
1000360490 5:160442350-160442372 TTGGAAAAAATGTGCTACCAAGG + Intergenic
1000383485 5:160650390-160650412 ATGTAACAAAGATCCCACCAAGG + Intronic
1002361125 5:178671837-178671859 CTGGATAACAGATGCTTCCAGGG - Intergenic
1004100308 6:12602714-12602736 CTGTAGAAAAGGTGCTTTCATGG + Intergenic
1004625191 6:17368983-17369005 CTGTCAAAATGATCTTACCATGG - Intergenic
1004700864 6:18078248-18078270 CTGTCAAAAAAAGGCTACCAGGG - Intergenic
1005831794 6:29676953-29676975 CTGTACAGAAGACGCTCCCATGG - Exonic
1008051899 6:46908767-46908789 ATGTAGGAAGGATGCTACCACGG + Intronic
1009469788 6:64018193-64018215 ATTTGAAAAATATGCTACCATGG + Intronic
1010149676 6:72716570-72716592 CTGTACAAAATATGGTACCCAGG - Intronic
1011574849 6:88785694-88785716 CTGTAGCAAGGATGTTACCATGG - Intronic
1012110403 6:95223593-95223615 CTGAAAAGAAGATGCCATCAAGG - Intergenic
1013591777 6:111624874-111624896 CAGTAGAACAGAGGCTACCAGGG + Intergenic
1017925910 6:158911691-158911713 TTGTATAAAAGATGTTTCCAAGG + Intergenic
1018475281 6:164134471-164134493 CAATTAAGAAGATGCTACCATGG - Intergenic
1021317463 7:19167217-19167239 CTGTAAAAAAGATTTTAAAAGGG - Intergenic
1026911140 7:74092670-74092692 CTGCCAAGGAGATGCTACCAGGG - Intronic
1028537955 7:91910258-91910280 CTCCAAAAAAGATGTCACCAAGG - Intergenic
1031880083 7:127187866-127187888 CTGTAAAAATGATACTACAATGG + Intronic
1035949158 8:3999964-3999986 TTATAAAAATTATGCTACCACGG + Intronic
1038310800 8:26444841-26444863 CTGTAAGCCAGATGCAACCAGGG - Intronic
1038678199 8:29642755-29642777 CTGGCAAAGTGATGCTACCATGG + Intergenic
1039633319 8:39135951-39135973 CTGAAAATAAGAAGCAACCAGGG - Intronic
1041627691 8:60049447-60049469 TAGTAAAAAAGATGTTGCCATGG + Intergenic
1042001840 8:64131959-64131981 CTTTAAAAAATATCTTACCAAGG - Intergenic
1042043349 8:64619929-64619951 CTGTAAAAAAAATATAACCAAGG + Intronic
1042353209 8:67799180-67799202 CTGTATCAAAGATGTAACCAGGG - Intergenic
1042739305 8:72025657-72025679 CTGTAAAAAAGACACTAAAAGGG + Intronic
1043781764 8:84345289-84345311 CAGTAAGATAGATGCTCCCAGGG + Intronic
1045247134 8:100452625-100452647 CGTTAAAAATGTTGCTACCAAGG + Intergenic
1045984557 8:108234519-108234541 CTGGAAAAAAGTTACTACTAAGG + Intronic
1047350806 8:124071759-124071781 CTATAATCAAGTTGCTACCAGGG + Intronic
1047728266 8:127703574-127703596 CTGTAGAAAAGATGTTAGCCAGG - Intergenic
1048157191 8:131968345-131968367 TCGTAAAAAAGATGCTCCCCGGG + Exonic
1048668142 8:136687490-136687512 CTGGAGAAAAGATGGAACCATGG + Intergenic
1048850571 8:138641456-138641478 CTGTAGAATACATGCTCCCAGGG + Intronic
1051470564 9:17435861-17435883 CCGTAAAAAAGGAGCTACCCTGG - Intronic
1051988995 9:23127981-23128003 TTGTGAGAAAGATTCTACCAAGG + Intergenic
1052752038 9:32501631-32501653 TAGTAATAAAAATGCTACCATGG + Intronic
1056148781 9:83764055-83764077 CTTTAAAAAAGATACTACAAAGG + Intronic
1056384511 9:86084525-86084547 CGGTTAAAAAGATATTACCAAGG + Intronic
1057504551 9:95622214-95622236 ATGCAAAGAAGATGCTACCTAGG + Intergenic
1058665567 9:107312277-107312299 CTGTATCAGAGATGCTACAATGG - Intronic
1059143137 9:111873326-111873348 CTGTTACAAAGATACTACCGAGG - Intergenic
1059498425 9:114729722-114729744 ATGTAAAATAGATACTAACAAGG - Intergenic
1061186418 9:129057160-129057182 CTGGAAAAAAAATGCCACAAAGG - Intronic
1186095029 X:6091318-6091340 ATTTTAAAAAGATGCTTCCAGGG - Intronic
1186874677 X:13805048-13805070 TTGGAAAAAAGATGCCTCCACGG - Intronic
1187242563 X:17527162-17527184 CTGTAATAAAGAGGGTACCCAGG + Intronic
1195476893 X:105297401-105297423 CTGCTATAAAGATACTACCAAGG + Intronic
1197393685 X:125898959-125898981 CAGTGAAAATGCTGCTACCATGG - Intergenic
1202043031 Y:20705928-20705950 CTGTAATAAAAATCCTCCCAGGG + Intergenic