ID: 1181527928

View in Genome Browser
Species Human (GRCh38)
Location 22:23500798-23500820
Sequence CCTTCAGGGGGAGATGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181527928_1181527940 28 Left 1181527928 22:23500798-23500820 CCCTGAGCATCTCCCCCTGAAGG No data
Right 1181527940 22:23500849-23500871 ACTCGCCTCTTAGGCAGCTTTGG No data
1181527928_1181527938 19 Left 1181527928 22:23500798-23500820 CCCTGAGCATCTCCCCCTGAAGG No data
Right 1181527938 22:23500840-23500862 GCCGTCAGCACTCGCCTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181527928 Original CRISPR CCTTCAGGGGGAGATGCTCA GGG (reversed) Intergenic