ID: 1181527938

View in Genome Browser
Species Human (GRCh38)
Location 22:23500840-23500862
Sequence GCCGTCAGCACTCGCCTCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181527935_1181527938 6 Left 1181527935 22:23500811-23500833 CCCCTGAAGGTGACGGCAGGGCA No data
Right 1181527938 22:23500840-23500862 GCCGTCAGCACTCGCCTCTTAGG No data
1181527936_1181527938 5 Left 1181527936 22:23500812-23500834 CCCTGAAGGTGACGGCAGGGCAG No data
Right 1181527938 22:23500840-23500862 GCCGTCAGCACTCGCCTCTTAGG No data
1181527930_1181527938 18 Left 1181527930 22:23500799-23500821 CCTGAGCATCTCCCCCTGAAGGT No data
Right 1181527938 22:23500840-23500862 GCCGTCAGCACTCGCCTCTTAGG No data
1181527934_1181527938 7 Left 1181527934 22:23500810-23500832 CCCCCTGAAGGTGACGGCAGGGC No data
Right 1181527938 22:23500840-23500862 GCCGTCAGCACTCGCCTCTTAGG No data
1181527937_1181527938 4 Left 1181527937 22:23500813-23500835 CCTGAAGGTGACGGCAGGGCAGA No data
Right 1181527938 22:23500840-23500862 GCCGTCAGCACTCGCCTCTTAGG No data
1181527926_1181527938 24 Left 1181527926 22:23500793-23500815 CCCTACCCTGAGCATCTCCCCCT No data
Right 1181527938 22:23500840-23500862 GCCGTCAGCACTCGCCTCTTAGG No data
1181527928_1181527938 19 Left 1181527928 22:23500798-23500820 CCCTGAGCATCTCCCCCTGAAGG No data
Right 1181527938 22:23500840-23500862 GCCGTCAGCACTCGCCTCTTAGG No data
1181527925_1181527938 30 Left 1181527925 22:23500787-23500809 CCATGTCCCTACCCTGAGCATCT No data
Right 1181527938 22:23500840-23500862 GCCGTCAGCACTCGCCTCTTAGG No data
1181527927_1181527938 23 Left 1181527927 22:23500794-23500816 CCTACCCTGAGCATCTCCCCCTG No data
Right 1181527938 22:23500840-23500862 GCCGTCAGCACTCGCCTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181527938 Original CRISPR GCCGTCAGCACTCGCCTCTT AGG Intergenic