ID: 1181527940

View in Genome Browser
Species Human (GRCh38)
Location 22:23500849-23500871
Sequence ACTCGCCTCTTAGGCAGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181527928_1181527940 28 Left 1181527928 22:23500798-23500820 CCCTGAGCATCTCCCCCTGAAGG No data
Right 1181527940 22:23500849-23500871 ACTCGCCTCTTAGGCAGCTTTGG No data
1181527936_1181527940 14 Left 1181527936 22:23500812-23500834 CCCTGAAGGTGACGGCAGGGCAG No data
Right 1181527940 22:23500849-23500871 ACTCGCCTCTTAGGCAGCTTTGG No data
1181527934_1181527940 16 Left 1181527934 22:23500810-23500832 CCCCCTGAAGGTGACGGCAGGGC No data
Right 1181527940 22:23500849-23500871 ACTCGCCTCTTAGGCAGCTTTGG No data
1181527935_1181527940 15 Left 1181527935 22:23500811-23500833 CCCCTGAAGGTGACGGCAGGGCA No data
Right 1181527940 22:23500849-23500871 ACTCGCCTCTTAGGCAGCTTTGG No data
1181527930_1181527940 27 Left 1181527930 22:23500799-23500821 CCTGAGCATCTCCCCCTGAAGGT No data
Right 1181527940 22:23500849-23500871 ACTCGCCTCTTAGGCAGCTTTGG No data
1181527937_1181527940 13 Left 1181527937 22:23500813-23500835 CCTGAAGGTGACGGCAGGGCAGA No data
Right 1181527940 22:23500849-23500871 ACTCGCCTCTTAGGCAGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181527940 Original CRISPR ACTCGCCTCTTAGGCAGCTT TGG Intergenic