ID: 1181531069

View in Genome Browser
Species Human (GRCh38)
Location 22:23517808-23517830
Sequence CTGGCGGCCTTGGCTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181531060_1181531069 5 Left 1181531060 22:23517780-23517802 CCAGGGAGTGTGATCGGCCCAAG No data
Right 1181531069 22:23517808-23517830 CTGGCGGCCTTGGCTGAGGAAGG No data
1181531059_1181531069 6 Left 1181531059 22:23517779-23517801 CCCAGGGAGTGTGATCGGCCCAA No data
Right 1181531069 22:23517808-23517830 CTGGCGGCCTTGGCTGAGGAAGG No data
1181531058_1181531069 7 Left 1181531058 22:23517778-23517800 CCCCAGGGAGTGTGATCGGCCCA No data
Right 1181531069 22:23517808-23517830 CTGGCGGCCTTGGCTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181531069 Original CRISPR CTGGCGGCCTTGGCTGAGGA AGG Intergenic
No off target data available for this crispr