ID: 1181531690

View in Genome Browser
Species Human (GRCh38)
Location 22:23520998-23521020
Sequence GTGGCTGGTGGGAGTCAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181531690_1181531706 10 Left 1181531690 22:23520998-23521020 CCCCACTGACTCCCACCAGCCAC No data
Right 1181531706 22:23521031-23521053 AGGGCCAGATGGGGCGGCTCCGG No data
1181531690_1181531705 4 Left 1181531690 22:23520998-23521020 CCCCACTGACTCCCACCAGCCAC No data
Right 1181531705 22:23521025-23521047 GGGAGTAGGGCCAGATGGGGCGG No data
1181531690_1181531702 0 Left 1181531690 22:23520998-23521020 CCCCACTGACTCCCACCAGCCAC No data
Right 1181531702 22:23521021-23521043 TGCCGGGAGTAGGGCCAGATGGG No data
1181531690_1181531708 26 Left 1181531690 22:23520998-23521020 CCCCACTGACTCCCACCAGCCAC No data
Right 1181531708 22:23521047-23521069 GCTCCGGATCCCGCCTCGCTCGG No data
1181531690_1181531697 -10 Left 1181531690 22:23520998-23521020 CCCCACTGACTCCCACCAGCCAC No data
Right 1181531697 22:23521011-23521033 CACCAGCCACTGCCGGGAGTAGG No data
1181531690_1181531703 1 Left 1181531690 22:23520998-23521020 CCCCACTGACTCCCACCAGCCAC No data
Right 1181531703 22:23521022-23521044 GCCGGGAGTAGGGCCAGATGGGG No data
1181531690_1181531698 -9 Left 1181531690 22:23520998-23521020 CCCCACTGACTCCCACCAGCCAC No data
Right 1181531698 22:23521012-23521034 ACCAGCCACTGCCGGGAGTAGGG No data
1181531690_1181531710 30 Left 1181531690 22:23520998-23521020 CCCCACTGACTCCCACCAGCCAC No data
Right 1181531710 22:23521051-23521073 CGGATCCCGCCTCGCTCGGCAGG No data
1181531690_1181531701 -1 Left 1181531690 22:23520998-23521020 CCCCACTGACTCCCACCAGCCAC No data
Right 1181531701 22:23521020-23521042 CTGCCGGGAGTAGGGCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181531690 Original CRISPR GTGGCTGGTGGGAGTCAGTG GGG (reversed) Intergenic
No off target data available for this crispr