ID: 1181539382

View in Genome Browser
Species Human (GRCh38)
Location 22:23565384-23565406
Sequence CTCCATAGGAGGCCTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181539372_1181539382 5 Left 1181539372 22:23565356-23565378 CCTTGAGGGACATAAGACCCAAT No data
Right 1181539382 22:23565384-23565406 CTCCATAGGAGGCCTGGGGAGGG No data
1181539371_1181539382 15 Left 1181539371 22:23565346-23565368 CCACAAGGAGCCTTGAGGGACAT No data
Right 1181539382 22:23565384-23565406 CTCCATAGGAGGCCTGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181539382 Original CRISPR CTCCATAGGAGGCCTGGGGA GGG Intergenic
No off target data available for this crispr