ID: 1181539721

View in Genome Browser
Species Human (GRCh38)
Location 22:23566719-23566741
Sequence TGAGCTCTGCCAAGGGCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181539713_1181539721 0 Left 1181539713 22:23566696-23566718 CCCGGCTCCGGGTGGGCGCGAGC No data
Right 1181539721 22:23566719-23566741 TGAGCTCTGCCAAGGGCCGGGGG No data
1181539712_1181539721 1 Left 1181539712 22:23566695-23566717 CCCCGGCTCCGGGTGGGCGCGAG No data
Right 1181539721 22:23566719-23566741 TGAGCTCTGCCAAGGGCCGGGGG No data
1181539714_1181539721 -1 Left 1181539714 22:23566697-23566719 CCGGCTCCGGGTGGGCGCGAGCT No data
Right 1181539721 22:23566719-23566741 TGAGCTCTGCCAAGGGCCGGGGG No data
1181539715_1181539721 -7 Left 1181539715 22:23566703-23566725 CCGGGTGGGCGCGAGCTGAGCTC No data
Right 1181539721 22:23566719-23566741 TGAGCTCTGCCAAGGGCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181539721 Original CRISPR TGAGCTCTGCCAAGGGCCGG GGG Intergenic
No off target data available for this crispr