ID: 1181541432

View in Genome Browser
Species Human (GRCh38)
Location 22:23575058-23575080
Sequence TCCTGCTCCAGCGCGGCTCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 2, 1: 1, 2: 1, 3: 12, 4: 175}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181541432_1181541442 17 Left 1181541432 22:23575058-23575080 CCAGGAGCCGCGCTGGAGCAGGA 0: 2
1: 1
2: 1
3: 12
4: 175
Right 1181541442 22:23575098-23575120 GGCACAGGGCTGCAGTGTGTAGG 0: 3
1: 0
2: 1
3: 32
4: 352
1181541432_1181541440 2 Left 1181541432 22:23575058-23575080 CCAGGAGCCGCGCTGGAGCAGGA 0: 2
1: 1
2: 1
3: 12
4: 175
Right 1181541440 22:23575083-23575105 CTGCTGGGAGTGAGGGGCACAGG 0: 1
1: 2
2: 6
3: 64
4: 526
1181541432_1181541437 -5 Left 1181541432 22:23575058-23575080 CCAGGAGCCGCGCTGGAGCAGGA 0: 2
1: 1
2: 1
3: 12
4: 175
Right 1181541437 22:23575076-23575098 CAGGAACCTGCTGGGAGTGAGGG 0: 1
1: 2
2: 1
3: 49
4: 386
1181541432_1181541443 29 Left 1181541432 22:23575058-23575080 CCAGGAGCCGCGCTGGAGCAGGA 0: 2
1: 1
2: 1
3: 12
4: 175
Right 1181541443 22:23575110-23575132 CAGTGTGTAGGCTGTGACCCAGG 0: 2
1: 0
2: 3
3: 13
4: 164
1181541432_1181541438 -4 Left 1181541432 22:23575058-23575080 CCAGGAGCCGCGCTGGAGCAGGA 0: 2
1: 1
2: 1
3: 12
4: 175
Right 1181541438 22:23575077-23575099 AGGAACCTGCTGGGAGTGAGGGG 0: 1
1: 2
2: 3
3: 40
4: 392
1181541432_1181541436 -6 Left 1181541432 22:23575058-23575080 CCAGGAGCCGCGCTGGAGCAGGA 0: 2
1: 1
2: 1
3: 12
4: 175
Right 1181541436 22:23575075-23575097 GCAGGAACCTGCTGGGAGTGAGG 0: 1
1: 2
2: 2
3: 48
4: 395
1181541432_1181541441 3 Left 1181541432 22:23575058-23575080 CCAGGAGCCGCGCTGGAGCAGGA 0: 2
1: 1
2: 1
3: 12
4: 175
Right 1181541441 22:23575084-23575106 TGCTGGGAGTGAGGGGCACAGGG 0: 1
1: 2
2: 5
3: 64
4: 511

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181541432 Original CRISPR TCCTGCTCCAGCGCGGCTCC TGG (reversed) Exonic