ID: 1181542151

View in Genome Browser
Species Human (GRCh38)
Location 22:23579415-23579437
Sequence TAGGAGACACAAGCTTATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181542151_1181542156 -8 Left 1181542151 22:23579415-23579437 CCTGGATAAGCTTGTGTCTCCTA 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1181542156 22:23579430-23579452 GTCTCCTAGGGGCTGGTTTCAGG 0: 1
1: 1
2: 0
3: 15
4: 149
1181542151_1181542157 -5 Left 1181542151 22:23579415-23579437 CCTGGATAAGCTTGTGTCTCCTA 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1181542157 22:23579433-23579455 TCCTAGGGGCTGGTTTCAGGAGG 0: 1
1: 0
2: 2
3: 11
4: 153
1181542151_1181542161 24 Left 1181542151 22:23579415-23579437 CCTGGATAAGCTTGTGTCTCCTA 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1181542161 22:23579462-23579484 TGGCTGAGGTCTAGTGACCCAGG 0: 1
1: 0
2: 2
3: 7
4: 134
1181542151_1181542160 10 Left 1181542151 22:23579415-23579437 CCTGGATAAGCTTGTGTCTCCTA 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1181542160 22:23579448-23579470 TCAGGAGGCGATGCTGGCTGAGG 0: 1
1: 0
2: 1
3: 36
4: 279
1181542151_1181542162 25 Left 1181542151 22:23579415-23579437 CCTGGATAAGCTTGTGTCTCCTA 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1181542162 22:23579463-23579485 GGCTGAGGTCTAGTGACCCAGGG 0: 1
1: 0
2: 1
3: 9
4: 159
1181542151_1181542159 4 Left 1181542151 22:23579415-23579437 CCTGGATAAGCTTGTGTCTCCTA 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1181542159 22:23579442-23579464 CTGGTTTCAGGAGGCGATGCTGG 0: 1
1: 0
2: 1
3: 6
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181542151 Original CRISPR TAGGAGACACAAGCTTATCC AGG (reversed) Intronic
910641797 1:89472182-89472204 CAGGAGACACAAGCTAAGCAAGG + Intergenic
914333665 1:146696551-146696573 TAGGAGAGAAAAGCTAATCTGGG - Intergenic
915747026 1:158169648-158169670 TATCAGACACAATCTGATCCTGG - Intergenic
917212014 1:172641122-172641144 CAGGAGACAAGAGCTCATCCCGG - Intergenic
1063199331 10:3772480-3772502 TAGGAGACAGGAGCTGCTCCAGG - Intergenic
1064522565 10:16218509-16218531 TTTGAGACACAAGGATATCCAGG + Intergenic
1069408663 10:68129554-68129576 TATGGTACACAAGCTTTTCCTGG + Intronic
1072367222 10:94724529-94724551 TAGGAGAAACAAGCTTACCTTGG - Exonic
1072378693 10:94843020-94843042 TAGGAGAAACAAACTTACCTTGG - Exonic
1072390560 10:94981366-94981388 TAGGAGAAACAAACTTACCTTGG - Exonic
1072396061 10:95042872-95042894 TAAGAGAAACAAGCTTACCTTGG + Exonic
1073034535 10:100554242-100554264 GAGGAGACAACAGCTTCTCCAGG - Exonic
1073689338 10:105790365-105790387 TAGGAGACACACCATTGTCCAGG + Intergenic
1083693905 11:64429897-64429919 GAGGAGACACTGGCTTAGCCTGG + Intergenic
1083852340 11:65375666-65375688 GAGGAGACATAGGGTTATCCTGG + Exonic
1084069330 11:66724058-66724080 TAGGAGTCACAAACTTACCAAGG + Intronic
1086840565 11:91678762-91678784 TTGGAAACACATGCTTATTCTGG - Intergenic
1091049955 11:132358463-132358485 TGGGTGACACAGGCTTATCTGGG - Intergenic
1096579370 12:52574579-52574601 TAGGACAAATAATCTTATCCAGG - Intergenic
1109494769 13:63155183-63155205 TAGGAGAGACCAGCTTCACCTGG - Intergenic
1111835177 13:93379126-93379148 TAGGAGACAGTATCTTCTCCTGG + Intronic
1112539300 13:100291706-100291728 TAGGAGACATATGCTCTTCCAGG - Intronic
1113298074 13:108984302-108984324 TGGGAGAGGCAAGCTAATCCAGG - Intronic
1113527600 13:110992539-110992561 TGGGAGACGCAAGCCAATCCCGG + Intergenic
1118422020 14:65616907-65616929 TAGGAGAAACAAATTTAACCAGG - Intronic
1128755341 15:70179996-70180018 CAGGAGACACATCTTTATCCTGG + Intergenic
1129706460 15:77797316-77797338 TAGGAGACACATGCTTCTGGGGG + Intronic
1135093820 16:19545713-19545735 TAGTAGAGAGAAGCTTTTCCAGG + Intronic
1136543139 16:30939938-30939960 TAGTAGAGACAAGGTTGTCCAGG - Intronic
1138596470 16:58031754-58031776 TAGGACACACATGCTTAGTCTGG - Intronic
1139999952 16:71014698-71014720 TAGGAGAGAAAAGCTAATCTGGG + Intronic
1141767835 16:86070414-86070436 CAGGACACACAAGCTGAGCCTGG + Intergenic
1146123635 17:30215749-30215771 GGGGAGACACAGGCTTACCCTGG + Intronic
1152903578 17:82958529-82958551 GGGGAGTCACAAGTTTATCCCGG - Intronic
1153679054 18:7483353-7483375 TAGGAGAGCCAAGCTTACTCAGG - Intergenic
1153968073 18:10200015-10200037 TAGAAGACACAAGATTTTCATGG + Intergenic
1157958255 18:52123480-52123502 AAGGAGGCACAAGCTTAGTCAGG + Intergenic
1160495916 18:79375128-79375150 TAGGAGACAGAGACCTATCCAGG - Intronic
1162023348 19:7879012-7879034 CAGGAGACACACGATTATCTGGG + Intergenic
927773872 2:25887002-25887024 TAGGAAAGAAAAACTTATCCGGG - Intergenic
931863625 2:66385468-66385490 TATGACACACAAGCATATCCTGG - Intergenic
934108489 2:88718499-88718521 TAGGAGGCCCAAGTTTATCTTGG - Intronic
939166659 2:138648090-138648112 TGGGAGGCACCAGCATATCCAGG - Intergenic
940488788 2:154330144-154330166 AAGGAGACACAATCTCATCTAGG + Intronic
941342284 2:164322217-164322239 TAGGAGAAACAAGCTTACCTTGG - Intergenic
1169657308 20:7939349-7939371 TAGGAGAAATAAAATTATCCTGG - Intronic
1173739532 20:45388385-45388407 TAGGAAAGAAAAGCTTATCCAGG - Intronic
1176962696 21:15177322-15177344 TGGGAGACACAAGGTTTTCAAGG - Intergenic
1177952462 21:27555615-27555637 TAGTAGCCACAAGATTCTCCAGG + Intergenic
1180125586 21:45788068-45788090 AAGGAGACACCAGCTGTTCCTGG - Intronic
1180238429 21:46480597-46480619 TGGGCCACACAAGCTTACCCAGG - Intronic
1181542151 22:23579415-23579437 TAGGAGACACAAGCTTATCCAGG - Intronic
1183280138 22:36927634-36927656 CAGGAGACAGAAGCCTCTCCAGG - Intronic
950919124 3:16676438-16676460 CAGGAGCCCCAAGTTTATCCTGG + Intergenic
951101839 3:18697590-18697612 TAGGACAAACACACTTATCCTGG + Intergenic
956277107 3:67514263-67514285 TAGGAAAGAAAAACTTATCCAGG + Intronic
960718513 3:120602210-120602232 TAGGAAAGAAAAACTTATCCAGG + Exonic
962872585 3:139510772-139510794 TAGGAGGCACAAGCACCTCCTGG + Intergenic
965658747 3:171018415-171018437 TGGGAGACACAAGGCCATCCTGG - Intronic
967258872 3:187622141-187622163 TTGGAATAACAAGCTTATCCAGG + Intergenic
967560505 3:190912681-190912703 AAGCAGTCACAAGCCTATCCAGG - Intergenic
968751987 4:2394968-2394990 AAGAAGACAGAAGCTTCTCCTGG - Intronic
969263378 4:6047520-6047542 CAGAAGACACAAGCTCAGCCAGG + Intronic
971080777 4:23208363-23208385 GTGGAGATACAAGCATATCCCGG - Intergenic
974049175 4:56924430-56924452 TAGGAGACAGAATATCATCCAGG - Intronic
974138299 4:57848839-57848861 AAGGAGATACAAACCTATCCCGG + Intergenic
979005438 4:115289357-115289379 TAGGAGACATATGCTTTTCTAGG + Intergenic
981934109 4:150220330-150220352 TAGGAGTCACATGGTTAGCCTGG + Intronic
984396130 4:179202094-179202116 TATGACACACAAACTTATACGGG + Intergenic
986846496 5:11762471-11762493 TATGAAACACTTGCTTATCCAGG + Intronic
990794946 5:59529194-59529216 TAGGAAAGAAAAACTTATCCAGG + Intronic
992192016 5:74302210-74302232 CAGAAGACACAACTTTATCCTGG - Intergenic
995861232 5:116642871-116642893 TATGAGTCACAAGCCCATCCAGG - Intergenic
995862671 5:116658753-116658775 TACCAGACACAAGCTTAACTTGG - Intergenic
996278745 5:121700818-121700840 TATGAGAAACAATCTTACCCAGG - Intergenic
998574334 5:143297334-143297356 TATGAAACACCAACTTATCCTGG - Intronic
1006327452 6:33365118-33365140 CAGGAGACACAAGATTATCTGGG + Intergenic
1007857025 6:44868452-44868474 TATGAGACACAGCCTCATCCAGG - Intronic
1011021864 6:82822965-82822987 TAAAAGAAACAAGCTAATCCTGG + Intergenic
1015528227 6:134193910-134193932 TAGACAACCCAAGCTTATCCTGG + Intronic
1017530417 6:155285165-155285187 TTGGGGACAAAAGCTTGTCCTGG + Exonic
1017724488 6:157267613-157267635 TAGGAGAGGCCAGCTCATCCTGG - Intergenic
1019210159 6:170398208-170398230 AAGGACACTCAAGGTTATCCAGG - Intronic
1021147824 7:17110762-17110784 CAGGAGACCCAAGTTTATCTTGG + Intergenic
1029362143 7:100095569-100095591 TAGGAGGGACAAGCTTTCCCGGG + Intronic
1031222875 7:118994191-118994213 AAGGAAACACAAGCTCCTCCAGG - Intergenic
1031954748 7:127930792-127930814 TTGGAGGCACAGGCATATCCAGG + Intronic
1033215476 7:139490359-139490381 GAATACACACAAGCTTATCCCGG + Intergenic
1038034256 8:23673863-23673885 TAGGAAACCCCAGCTTATTCTGG - Intergenic
1040049867 8:43003296-43003318 TGGGAGACACAAGATACTCCTGG + Intronic
1041178397 8:55221696-55221718 AGGGAGACACAAGCTCTTCCAGG + Intronic
1042182303 8:66103370-66103392 TTGGAAACACAAGGTCATCCTGG - Intergenic
1042545236 8:69945450-69945472 GAGGAGTCAAAAGTTTATCCTGG - Intergenic
1044186088 8:89253867-89253889 ATGGAGCCACAAGCTGATCCTGG - Intergenic
1053513829 9:38712161-38712183 TAGGAGAAAAAAGCTTATACTGG + Intergenic
1056562105 9:87739638-87739660 CAGGAGACAAAAGCTTACCACGG + Intergenic
1061507879 9:131042021-131042043 TAGGAGAGACCATCTAATCCAGG + Intronic
1061629054 9:131860093-131860115 CAGGAGACAAAGCCTTATCCAGG + Exonic
1061800519 9:133111222-133111244 GAGGAAACAGAGGCTTATCCAGG + Intronic
1061963697 9:134001356-134001378 GAGGAGACAGAAGCTCATGCTGG - Intergenic
1186230132 X:7444864-7444886 AAGCACACACAAGCTTAACCTGG + Intergenic
1187025417 X:15430505-15430527 AAGGAGAGACAAGGTTTTCCTGG - Intronic
1187185092 X:16976971-16976993 CAGGAGACTCAGGCTTGTCCTGG - Intronic
1187194661 X:17071660-17071682 TGGGAGACACAAGCGTTTCAAGG + Intronic
1188048679 X:25457935-25457957 TAGGAGAAGAAAGCTTATTCTGG - Intergenic
1188790813 X:34405897-34405919 TGGGAGAAACAAGCATATTCAGG - Intergenic
1189001189 X:36949034-36949056 TATGAGACACAAGGATACCCTGG + Intergenic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic