ID: 1181543604

View in Genome Browser
Species Human (GRCh38)
Location 22:23587848-23587870
Sequence CAGTGCAGACGCAATTAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181543604_1181543607 8 Left 1181543604 22:23587848-23587870 CCACCTTAATTGCGTCTGCACTG No data
Right 1181543607 22:23587879-23587901 TAGCAAGATTCCTGCTAAGTGGG No data
1181543604_1181543606 7 Left 1181543604 22:23587848-23587870 CCACCTTAATTGCGTCTGCACTG No data
Right 1181543606 22:23587878-23587900 TTAGCAAGATTCCTGCTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181543604 Original CRISPR CAGTGCAGACGCAATTAAGG TGG (reversed) Intergenic
No off target data available for this crispr