ID: 1181547094

View in Genome Browser
Species Human (GRCh38)
Location 22:23608244-23608266
Sequence GGCCTCTGGCAGCATGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 251}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181547094_1181547100 -7 Left 1181547094 22:23608244-23608266 CCCTCACCATGCTGCCAGAGGCC 0: 1
1: 0
2: 1
3: 15
4: 251
Right 1181547100 22:23608260-23608282 AGAGGCCCCTGAGGGCTGCAAGG 0: 1
1: 0
2: 6
3: 52
4: 427
1181547094_1181547108 29 Left 1181547094 22:23608244-23608266 CCCTCACCATGCTGCCAGAGGCC 0: 1
1: 0
2: 1
3: 15
4: 251
Right 1181547108 22:23608296-23608318 TATGCACACCTTCCGTGTCCTGG 0: 1
1: 0
2: 0
3: 3
4: 65
1181547094_1181547104 2 Left 1181547094 22:23608244-23608266 CCCTCACCATGCTGCCAGAGGCC 0: 1
1: 0
2: 1
3: 15
4: 251
Right 1181547104 22:23608269-23608291 TGAGGGCTGCAAGGTCCTGCAGG 0: 1
1: 0
2: 4
3: 30
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181547094 Original CRISPR GGCCTCTGGCAGCATGGTGA GGG (reversed) Intergenic
901273899 1:7975374-7975396 GGCCTCTGGAAGCAAGGTCTTGG + Intronic
901853190 1:12029054-12029076 GGCCTCAGGCTGGCTGGTGATGG - Exonic
903483431 1:23671197-23671219 GGAACCTGGCAGCAAGGTGAGGG + Intergenic
906283417 1:44569582-44569604 TGCCTCTGGCAGCAAAGTCATGG - Intronic
908790137 1:67772906-67772928 TACCTCTGCCACCATGGTGAGGG + Intronic
909176732 1:72371038-72371060 GGCCTTTGGCTGCAGAGTGAAGG + Intergenic
915249318 1:154577223-154577245 GGCCTCTGGAAGCAGAGTCAGGG - Exonic
915590960 1:156869980-156870002 GGCCCCTGGAACCATGTTGAGGG + Intronic
916826713 1:168448961-168448983 TGCTTCTGGCAGCATGGGAAGGG - Intergenic
917099504 1:171431211-171431233 GGCCCCTGGCAGCATCTTGGGGG + Intergenic
917592254 1:176488417-176488439 AGCCTCTGGAAGCAGAGTGATGG + Intronic
920322405 1:205134592-205134614 GGCAGTGGGCAGCATGGTGAGGG - Intergenic
920712889 1:208311817-208311839 GGTCTCTGGAGCCATGGTGAGGG + Intergenic
920791881 1:209100781-209100803 GGCCTGAGGCAGCATGTTGGTGG + Intergenic
1066096887 10:32080795-32080817 TTCCTCTGGCTGCATGTTGAAGG + Intergenic
1067059771 10:43072252-43072274 GGCTTCTGGTTGCATGGGGAGGG + Intergenic
1067553518 10:47252264-47252286 GGCCTCAGCCAGCAGGATGAAGG - Intergenic
1067923176 10:50480723-50480745 GGCCAGTGGCAGCAGGCTGAAGG + Intronic
1067930780 10:50559308-50559330 CGCCTCTGGCAGCTGGGTCAGGG - Intronic
1068045492 10:51881062-51881084 GGCCTCTGGAAGCATAGTTCAGG + Intronic
1068502693 10:57860323-57860345 GGCTTCTCACAGCATGGTGGTGG + Intergenic
1069163527 10:65119508-65119530 GGCCTCTGGCCACAGGCTGAAGG + Intergenic
1069656421 10:70092597-70092619 GGACTCTTGCAGCTTGGTGCCGG + Intronic
1069872397 10:71541050-71541072 GGGCTCTGGCAGCATGTGCAAGG - Intronic
1069907357 10:71739658-71739680 GGCCTCTGGCAACATCGCGGGGG + Intronic
1073716576 10:106114818-106114840 GGCAGCAGGCAGCATAGTGATGG - Intergenic
1074463917 10:113665504-113665526 GGGCTCTCTCAGCATGGGGAGGG + Intergenic
1075401154 10:122162743-122162765 GGGCACTGGGAGCTTGGTGATGG + Intronic
1076330063 10:129657612-129657634 GGCCTCTGACAGCCTGGAGGAGG + Intronic
1078056576 11:8014136-8014158 TTCCTCTGGCAGCAGAGTGAGGG + Intergenic
1081704361 11:45172324-45172346 GGCCTCTGGCAACAAGAAGAGGG - Intronic
1082795339 11:57374831-57374853 GGCCTCTGGCAGCAGGAGAATGG - Intergenic
1084005216 11:66318995-66319017 TCCCTCTGGCAGGATGGAGAGGG - Intergenic
1084008408 11:66334980-66335002 TGCCCCTGGCAGCACGGGGACGG + Exonic
1084166321 11:67376319-67376341 GGGCACTGGCAGCTTGGAGATGG - Intronic
1084190367 11:67495933-67495955 GCCCCCTGGCAGCATGATGCTGG - Intronic
1084495326 11:69500107-69500129 CGCCTCCGGCAGCACTGTGATGG + Intergenic
1084657412 11:70527547-70527569 GGCCTCCAGCAGCCTGGAGATGG + Intronic
1086055263 11:82639493-82639515 GACTTCAGGCAGCATGGAGAAGG - Intergenic
1086742447 11:90384287-90384309 GGCCTCTGGCTACATGGTTAAGG - Intergenic
1089870874 11:121671695-121671717 GGTGTGTGGCAGCATGGCGAGGG + Intergenic
1090744094 11:129693049-129693071 GACTGCTGGGAGCATGGTGAGGG - Intergenic
1092173006 12:6384899-6384921 GGCCACTGGCAGGATGATGGGGG + Intronic
1093920051 12:24849418-24849440 GGTCTCTGGCTGCAGGCTGACGG - Intronic
1094594137 12:31848500-31848522 TGCCTGTGGCAGGATGGGGAAGG - Intergenic
1096053039 12:48628006-48628028 GGCCACAGCCAGCATGATGAGGG - Intergenic
1097192168 12:57224815-57224837 GGGCTCTGGCAGGATGGCGGGGG + Intronic
1097345478 12:58487494-58487516 GGCCTCAGGCAGCAAGCTGTTGG + Intergenic
1099735124 12:86557502-86557524 GTCCTCAGGCACCATGGTGGTGG - Intronic
1100227335 12:92572495-92572517 GGCCTCTGACCTCATGGTGGAGG - Intergenic
1103150883 12:118637579-118637601 TTCCTCTGGCAGCAGGGAGAAGG + Intergenic
1103904260 12:124319431-124319453 CGCCCCTGCCATCATGGTGAGGG + Intergenic
1103924939 12:124418450-124418472 GACCTCTGGCAGCCTGGGAAAGG + Intronic
1104871610 12:132002595-132002617 GGGCTCTGGTTGCATGCTGAGGG + Intronic
1105836692 13:24218171-24218193 GGACTCTGGCAGCAGAGTGAAGG + Intronic
1106331830 13:28746451-28746473 TGCCTCTGACACAATGGTGATGG + Intergenic
1106926551 13:34619104-34619126 GTCCTCTGGCAAAATGGTTAGGG + Intergenic
1108893552 13:55294470-55294492 GGCCTCTGGGTCCATGATGAGGG - Intergenic
1111749989 13:92317263-92317285 GGCCATTGGCAGCAAGGGGAGGG + Intronic
1112033231 13:95475605-95475627 GGCCTCTGGGCCCCTGGTGAGGG + Intronic
1112675413 13:101695723-101695745 AGTCTCTTGCAGCAGGGTGAAGG - Intronic
1113417408 13:110138849-110138871 GGCCTCTGGAGGGATGGAGAGGG - Intergenic
1113571299 13:111360109-111360131 GTCCCCTCACAGCATGGTGAGGG - Intergenic
1113732149 13:112649234-112649256 GGCCTCTTGCAGCAAGATGTAGG - Intronic
1113967861 13:114164687-114164709 GGCCTCGGGCTGAATGGTGGAGG - Intergenic
1118016445 14:61665952-61665974 TGCTTCTGTCAGCAAGGTGAGGG - Intergenic
1118678428 14:68213957-68213979 GGACTCTGGCATCAGGTTGATGG + Intronic
1119203561 14:72777104-72777126 GGCCTGTGGCAGGATTGTGGGGG + Intronic
1119599019 14:75962178-75962200 GGCCTGTAGCAGCAGGGTTAGGG - Intronic
1119616145 14:76100282-76100304 GGCATCTGGTAACATGGTAATGG + Intergenic
1119859389 14:77925362-77925384 GGCAGCTGGCGGCAGGGTGAGGG + Intronic
1121457374 14:94047022-94047044 GTCCTGAGGCAGCAAGGTGAGGG - Exonic
1121889333 14:97574423-97574445 GGCCCCTGGCACCAAGGAGAAGG + Intergenic
1122901033 14:104782446-104782468 GGCTTGTGGCAGCAGGGTCAGGG - Intronic
1126145037 15:45466057-45466079 GGCCTCTGGCCACAGGCTGAAGG + Intergenic
1126653927 15:50955833-50955855 TACCTCTTGCAGCCTGGTGAGGG + Intronic
1128418778 15:67472071-67472093 GAACTCTGGCAGCAAGCTGAGGG - Intronic
1128574976 15:68767578-68767600 AGCCTCTGCCAGCATGGAAATGG - Intergenic
1128956139 15:71947698-71947720 AGGCACTGTCAGCATGGTGAGGG + Intronic
1129456139 15:75677040-75677062 GGCCTTTGCCATCACGGTGAGGG - Exonic
1131098368 15:89670019-89670041 GGCCTTGGGCAGCATTGAGAAGG - Exonic
1134361882 16:13539061-13539083 GGTCTTTGGCATCATGATGAGGG + Intergenic
1135977808 16:27122375-27122397 GGCCTCTGGCTGCAGACTGAAGG - Intergenic
1136160272 16:28415259-28415281 GGCCTTTGGCATGATGCTGATGG - Intergenic
1136202816 16:28700031-28700053 GGCCTTTGGCATGATGCTGATGG + Intronic
1136245034 16:28970188-28970210 GGCCTAGGACAGCATGGAGACGG - Intergenic
1137570211 16:49560495-49560517 TCCCTCTCGCAGCATGATGAAGG + Intronic
1137676970 16:50308589-50308611 GGTCGCTGGCAGCCTGGGGAGGG - Intronic
1138657407 16:58499357-58499379 AGCCCCTGGCAGCAGGGTGAGGG + Intronic
1139198873 16:64951945-64951967 CACCTCTGCCAGCATGGTGGAGG + Intronic
1139440653 16:66964994-66965016 TGCCCCAGGCAGCATGGTGGAGG + Intronic
1140094003 16:71859903-71859925 TGCCTCTGGCAGCAAGGACAGGG + Exonic
1140271188 16:73467789-73467811 AGCAGCTGGCAGAATGGTGAAGG + Intergenic
1140977556 16:80074740-80074762 GGCCTCTGGAGGCATTTTGATGG - Intergenic
1141192441 16:81834332-81834354 GGCTGCTGGCAGAATTGTGAGGG + Intronic
1141501633 16:84448793-84448815 GGAGTCAGGCAGCATGCTGACGG + Intronic
1141594685 16:85090014-85090036 GCACACTGGCAGCATGGTCACGG - Exonic
1143767873 17:9149480-9149502 GACCCCCAGCAGCATGGTGAGGG - Intronic
1144732675 17:17537518-17537540 GGCCTGGGCCAGCATGGGGAAGG - Intronic
1145886883 17:28388143-28388165 GGCAATAGGCAGCATGGTGAAGG - Intronic
1145921602 17:28614054-28614076 GGGCTCTGGCAGCCTACTGAGGG - Intronic
1146133466 17:30297798-30297820 GGACTCTGGCATCCAGGTGAGGG - Intergenic
1146630622 17:34466839-34466861 GGCCTTTGTCAGCAGAGTGAGGG - Intergenic
1146913951 17:36666135-36666157 TCCCTCTGGCAGCATGGCCACGG - Intergenic
1147150500 17:38511062-38511084 GGCCCCTGGGTGCATGGTGTGGG + Exonic
1148700001 17:49581546-49581568 GGCCCCTGGAAGCATGATGTGGG - Intronic
1149224509 17:54453772-54453794 TGCCTATGGCAGGATGGGGAAGG - Intergenic
1149543663 17:57487528-57487550 TCCCTCTGGCAGCATGGAAAGGG - Intronic
1151995494 17:77606181-77606203 TGCCCCTGGGAGCATTGTGAGGG + Intergenic
1152531029 17:80919285-80919307 GGCCGCTGGCTGCTTGGTGGGGG - Intronic
1152661529 17:81544533-81544555 CACCTCTGGCAGCAGGGTTAGGG + Intronic
1153521765 18:5960810-5960832 GGCATGTGGGGGCATGGTGAGGG - Intronic
1153988724 18:10376317-10376339 GGTCTCTGGCAGGCTGGTGCAGG + Intergenic
1154462934 18:14613893-14613915 CTCCTCTGTAAGCATGGTGAAGG + Intergenic
1155399938 18:25427031-25427053 GGCCTCTGCCAGCAGGATCAGGG + Intergenic
1157591310 18:48837806-48837828 GGCATCTGGGAGCAGGGAGAGGG - Intronic
1158476640 18:57785873-57785895 CTCCTCTGGCAGCTTAGTGAAGG + Intronic
1160456939 18:79008297-79008319 AGCCTCGGGCAGCATGGAGAGGG - Intergenic
1160622872 18:80182939-80182961 GGCGTCTGGCTGCGTGGTGTGGG - Intronic
1161730804 19:5959447-5959469 GGCTTCGGGGAGCATGGTGGGGG - Intronic
1161857407 19:6773525-6773547 GGCCTGGGGCAGCATGGGGCAGG + Intronic
1162065632 19:8123740-8123762 GGCCCCTGGAAGGATGGGGAGGG - Intronic
1162391227 19:10391307-10391329 GGCCTTTGGCATAATGCTGATGG + Exonic
1162810075 19:13158774-13158796 GAACTTTGGCAGCATGGTGGAGG + Intergenic
1163018270 19:14469973-14469995 GGCCTCTGCAAGGAGGGTGAGGG + Exonic
1163622387 19:18368824-18368846 GGCCTCTGGGAGCTGCGTGACGG + Exonic
1163654460 19:18537803-18537825 GGTGTCTGGTGGCATGGTGACGG - Intronic
1164711460 19:30359818-30359840 AGCTTCAGTCAGCATGGTGAAGG - Intronic
1167671185 19:50854807-50854829 AGCCTCCAGCAGCATGGGGAGGG + Intergenic
1167673956 19:50873325-50873347 AGCCTCCAGCAGCATGGGGAGGG + Exonic
926050026 2:9738842-9738864 GGCCTCTGGCTTGCTGGTGAGGG + Intergenic
926750849 2:16197480-16197502 GGGCCCTGGCAGCATGGGAAGGG - Intergenic
926964519 2:18395724-18395746 GTCCTCTGCCAGCTTGCTGATGG + Intergenic
927104696 2:19813040-19813062 GGCCTCTGGCCACAAGGTCAAGG + Intergenic
928123298 2:28599298-28599320 GGCCTCTAGGAGCAGGGTGGGGG - Intronic
928143713 2:28752354-28752376 GGCCTCTGGGAGCGCGGTCAGGG + Intronic
929367581 2:41178806-41178828 GGTCTCTGCCTGCATGGTGTTGG + Intergenic
931176083 2:59856574-59856596 GGCAACTGGCAGCATGGTTTGGG - Intergenic
931306261 2:61031746-61031768 TGCCTCTGTCAGTATGATGATGG + Exonic
933614407 2:84469562-84469584 TGCCTGTGGCAGCGTGGGGAAGG + Intergenic
933694651 2:85208686-85208708 GGCCTCTGGAAGGATGGAAATGG + Intronic
934780832 2:96968658-96968680 GGCCCCTGGGAGGAGGGTGATGG - Intronic
934943562 2:98520069-98520091 GGGCCCTGGCACCATGGCGAGGG - Exonic
937279297 2:120706269-120706291 GGCAGCTGGCAGCAAGGAGAGGG - Intergenic
937311551 2:120906121-120906143 GGTCTCAGGCAGCACGGTGCGGG + Intronic
937409288 2:121658958-121658980 GAACTTTGGCAGCATGGTGGAGG + Intergenic
946422997 2:219575375-219575397 GGCCCCTGGCAGCAAGGAGTAGG - Exonic
948194950 2:236088216-236088238 GGCCTCTCTCAGTAAGGTGAAGG - Intronic
948569938 2:238911436-238911458 GGTCTCTGGCAGGATGGTGGTGG + Intergenic
1169191006 20:3659387-3659409 AGACTCTGCCAGCATGGTCATGG + Intronic
1169622578 20:7524670-7524692 AGCCTTTGCCAGCATGGGGATGG - Intergenic
1170546306 20:17437994-17438016 GTCCTCTGGGAGCACGGTGTGGG - Intronic
1172770662 20:37380673-37380695 GGTCTCTGGGGGCATGGAGATGG + Intronic
1173144339 20:40511675-40511697 GGGCTCTGGCATCATCGTGCAGG - Intergenic
1175812197 20:61864393-61864415 GGTTTCTGGCTGCATGGGGAGGG - Intronic
1175994480 20:62805929-62805951 GGCGCCTGGCAGGATGGTCAGGG - Intronic
1176074334 20:63241627-63241649 GGCCTTTGGCAGAAAGGAGATGG + Intronic
1176305350 21:5120336-5120358 GGCCTCTGACACCAGGCTGAGGG + Intronic
1176811592 21:13544479-13544501 CTCCTCTGTAAGCATGGTGAAGG - Intergenic
1178086076 21:29113401-29113423 GGCCTCTGGGAGAACAGTGAAGG - Intronic
1178149496 21:29777678-29777700 GGCCAATGGCAGCACGCTGAAGG + Intronic
1178490701 21:33049446-33049468 GGCCTATGGGGTCATGGTGATGG + Intergenic
1179851705 21:44141695-44141717 GGCCTCTGACACCAGGCTGAGGG - Intronic
1180090003 21:45529115-45529137 GGCCTCGGGGAGCCTGGAGAAGG + Intronic
1180242932 21:46523932-46523954 TGCCTATGGCAGTATGGGGAAGG + Intronic
1180790017 22:18570773-18570795 GGCCTCTGGAGGCCTGTTGATGG - Intergenic
1181021195 22:20104118-20104140 GGCCTCAGGCAGCTTGGTGCAGG + Intronic
1181101866 22:20546150-20546172 GGCCCCTCCCAGCCTGGTGAAGG + Intronic
1181246929 22:21510326-21510348 GGCCTCTGGAGGCCTGTTGATGG - Intergenic
1181455813 22:23059603-23059625 GGCCTCTGCCAGCATGGTAAGGG + Exonic
1181547094 22:23608244-23608266 GGCCTCTGGCAGCATGGTGAGGG - Intergenic
1181577218 22:23802644-23802666 GGCGTCTGGGAGCATGGAGAGGG - Intronic
1181990783 22:26835220-26835242 GCCCTGTGGCAGCAGGGTCACGG + Intergenic
1182554648 22:31122715-31122737 GGCCTACGGCAGAAAGGTGAAGG + Intronic
1182922239 22:34090440-34090462 GGACTCTGGCAGGGTAGTGATGG + Intergenic
950334852 3:12185498-12185520 GCCCTCAGGCAGCATGCTTAGGG + Intronic
950585309 3:13888117-13888139 GGACTTTGGCAGCAGGGGGAGGG - Intergenic
954293762 3:49663037-49663059 GGCCTGTGGCCTCATGATGAGGG + Exonic
954661914 3:52230921-52230943 GGCCTCAGGCTGCAGGGGGAAGG + Exonic
956812535 3:72878071-72878093 GGCCACTTGCAGCAGGCTGACGG - Intergenic
957467734 3:80616487-80616509 GGGCTATGGCAGCAAGGAGATGG + Intergenic
957577551 3:82029345-82029367 GACCTATGGCCCCATGGTGAAGG + Intergenic
962437326 3:135379217-135379239 CTGCTCTGGCAGCATGGTGCTGG - Intergenic
962845437 3:139270078-139270100 GGCCTATGGCAGCAGGGAGAGGG + Intronic
966648409 3:182271789-182271811 GCCCTCTGGCAGCCAGGTGGGGG + Intergenic
966958396 3:184908590-184908612 GGCCTCTGGCCCCATTGTGTGGG + Intronic
968062967 3:195740001-195740023 GGATTCTGGCAGCCAGGTGAGGG + Intronic
968734843 4:2290065-2290087 GGCCTCAGCCAGCAGCGTGATGG + Intronic
972116817 4:35646482-35646504 GGCCTCTGGCCACAGGCTGAAGG - Intergenic
972356371 4:38282688-38282710 GTCCTCTGGCTGAATGGGGATGG - Intergenic
973824744 4:54693731-54693753 CACCTCTTGCAGAATGGTGAAGG - Intronic
977028442 4:91851671-91851693 GTGCTCTGGCAGGATGGTGGGGG - Intergenic
982337465 4:154256802-154256824 GAACTCTGGCAGCAAAGTGAAGG - Intronic
985536213 5:467080-467102 GGCCTTTGACAGCACAGTGAGGG - Exonic
985922481 5:2989450-2989472 GGCCACTGACAGCACGCTGAGGG + Intergenic
994265762 5:97714581-97714603 GAACTCTGGCATTATGGTGAAGG + Intergenic
996422286 5:123276012-123276034 GACCTCTGGTAGCATGGGGGTGG - Intergenic
996504260 5:124251894-124251916 AGCATCTGGCAGGATGGGGATGG + Intergenic
997182431 5:131844007-131844029 GGCCTCAGGAAACATGGTTACGG + Intronic
997294339 5:132760415-132760437 GCCCTGTTGCAGCGTGGTGAAGG - Intronic
999228934 5:150050115-150050137 GGGCTCTGGCAGGATGGCCATGG + Intronic
1001036442 5:168300091-168300113 TGCCTCTCCCAGCATGGAGATGG + Intronic
1001412605 5:171521439-171521461 GGCCTGTGCCAGCCTGGTGTCGG + Intergenic
1001552275 5:172611718-172611740 GGACTCTTGCAGGATGGTCAAGG + Intergenic
1001692597 5:173644074-173644096 GGCCTCTGGTGCCATGGTGACGG + Intergenic
1001723649 5:173877649-173877671 GACTTCTTGCAGCATGGAGAAGG + Intergenic
1001894110 5:175363893-175363915 GGCCCCTGAGAGCATGGAGAAGG + Intergenic
1002323546 5:178390089-178390111 GGCCTCTGGTAGCTTTGAGAGGG - Intronic
1002340883 5:178515929-178515951 GGCGTCTGGCAGGGTGGCGAAGG - Intronic
1002594204 5:180311787-180311809 GGCCTCTGTGAGCATGGCCAGGG + Intronic
1003235791 6:4294453-4294475 AGCCTCTGGGGGCAAGGTGAGGG - Intergenic
1004368115 6:15029093-15029115 GGCCTCAGGCAGCACTGTGTGGG - Intergenic
1006914557 6:37585905-37585927 GGACTCTGGGAGCCTGGGGATGG - Intergenic
1007213372 6:40216400-40216422 TGGCTCAGGCACCATGGTGAAGG + Intergenic
1007605705 6:43116367-43116389 GGCCTGTGGCAGCAGGCTGCGGG - Intronic
1007750828 6:44070263-44070285 GCCCTCTGCCAGCATGGGCATGG - Intergenic
1011283874 6:85704107-85704129 GGCCTCAGGGTGCAAGGTGAAGG - Intergenic
1016385420 6:143526165-143526187 GACCTCTGGCATCTTAGTGACGG + Intergenic
1016571537 6:145519012-145519034 GGGCTCTGGCAGCAGAGTGTGGG - Intronic
1019065512 6:169292738-169292760 GGCCTCTTGCTGCAGGGTGCCGG - Intergenic
1019151672 6:170010722-170010744 GGGCTCCTGCAGCATGGTCAGGG + Intergenic
1021659848 7:22909033-22909055 GTCCTCTCCCAGCATGGTCATGG - Intergenic
1024084547 7:45882619-45882641 GGCCTCTGCCAGCAATTTGATGG - Intergenic
1026282057 7:68930801-68930823 GGGCTCTGACAGCTTAGTGAGGG - Intergenic
1031976826 7:128099265-128099287 GCCCTCAAGCAGCAGGGTGAGGG - Intergenic
1035024343 7:155816253-155816275 GGCCTGTGGCAGCTTGGGGGTGG - Intergenic
1035877469 8:3206996-3207018 GGCCACAGCCAGCATGGTAAGGG - Intronic
1036389207 8:8310087-8310109 GGCCTCTGGTAGCAGTTTGATGG - Intergenic
1037484948 8:19338421-19338443 TGCCTCTGGGACCATGGTTAAGG + Intronic
1039955150 8:42201698-42201720 GGCCTCTGCATGCATGGTGTGGG - Intronic
1040285654 8:46099203-46099225 GGCCACAGGCAGGCTGGTGAGGG + Intergenic
1041250596 8:55930714-55930736 GGCTTCTTGCAGCATGTTGATGG + Intronic
1043052811 8:75404364-75404386 GGGCTCGGCCAGCAGGGTGAGGG - Intergenic
1045111887 8:98944432-98944454 GGCCTGGGGCAGCCTGGGGAGGG + Exonic
1045555767 8:103213339-103213361 GGCCACTGTCACCATGTTGATGG + Intronic
1049009678 8:139879180-139879202 GGACTCTGGAAGAATGGTGAGGG + Intronic
1049073522 8:140375502-140375524 TGTCTCTGGCAGGATGGAGAGGG + Intronic
1049217483 8:141414868-141414890 GGCCTAGGGCAGCATCCTGATGG + Intronic
1049339908 8:142106541-142106563 GGCCTCTGCCAGCAAGGGGACGG - Intergenic
1049346787 8:142143536-142143558 TGCCTGTGGCAGGAGGGTGAGGG - Intergenic
1049552501 8:143267096-143267118 GGCCGCGGGCAGCGTGGGGACGG + Intronic
1051779864 9:20678578-20678600 GGCCTCCTGCAGCACTGTGAAGG - Intronic
1052736211 9:32345064-32345086 AGCCTCTGGCAACATGGACAAGG + Intergenic
1053316203 9:37053899-37053921 TGTCACTGGCAGCATGGTGGGGG + Intergenic
1056055906 9:82823809-82823831 TGCCTCTGCCAACATGGTTAAGG - Intergenic
1056598272 9:88025583-88025605 GCACTCTGGCAGCTTGGGGAGGG + Intergenic
1056711827 9:88997820-88997842 TCCATTTGGCAGCATGGTGAGGG + Exonic
1057336207 9:94157080-94157102 GGCCTCGGGCAGCCTGGCCACGG - Intergenic
1058539417 9:105996013-105996035 CATCTCAGGCAGCATGGTGAGGG - Intergenic
1059462565 9:114443396-114443418 GGCCTCTGGTAGCTTGGAAAGGG - Intronic
1060352832 9:122874018-122874040 GTGCTATGGCAGCATGGTGAAGG + Intronic
1060508505 9:124215768-124215790 GGCCTGCAGCAGCATGGTGCAGG - Intergenic
1061392721 9:130326859-130326881 GACCTCTCGAAGCCTGGTGAGGG - Intronic
1061476072 9:130867515-130867537 GTACTCTGGCAGTATGGTCAAGG - Intronic
1061693276 9:132353071-132353093 GGCCTCTGGCAGCATTTTGGAGG - Intronic
1062129785 9:134886063-134886085 AGGCTCTGGCAGCATCGGGACGG + Intronic
1062176136 9:135164118-135164140 GGGCACTGGCAGCAGGGAGAAGG + Intergenic
1062268484 9:135698280-135698302 GTCCTCCGGCATCACGGTGATGG - Intronic
1062654016 9:137592764-137592786 GTCCCCTTGCAGCAGGGTGAAGG - Intergenic
1186862852 X:13690144-13690166 GGTCTCTGGCACCATTGTAATGG + Intronic
1186909488 X:14146760-14146782 TCCCTCTGGCAGCACTGTGAAGG + Intergenic
1189263057 X:39691713-39691735 GGCTTCTCACAGCATGGTGGTGG + Intergenic
1189762163 X:44332765-44332787 GGCCTCTTGCACCATGCTGAGGG - Intronic
1190078758 X:47338541-47338563 ACCCTCTGCCAACATGGTGAGGG - Intergenic
1192260519 X:69503895-69503917 GTCCTCGGGCAGGACGGTGAGGG + Intergenic
1196162309 X:112499520-112499542 TGCCTGTGGCAGGGTGGTGAAGG + Intergenic
1197106315 X:122720730-122720752 GGCCCCGGACAACATGGTGAAGG - Intergenic
1197823323 X:130563409-130563431 TGCAACTGGCAGAATGGTGAGGG + Intergenic