ID: 1181548562

View in Genome Browser
Species Human (GRCh38)
Location 22:23620982-23621004
Sequence TCTGTGAGGATGGAGTTCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2906
Summary {0: 1, 1: 2, 2: 11, 3: 243, 4: 2649}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181548562 Original CRISPR TCTGTGAGGATGGAGTTCAG CGG (reversed) Intronic
Too many off-targets to display for this crispr