ID: 1181549728

View in Genome Browser
Species Human (GRCh38)
Location 22:23630803-23630825
Sequence TCCAGGTCCTCACTCCTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181549726_1181549728 -1 Left 1181549726 22:23630781-23630803 CCATCTGTTTCTCACACTGCACT No data
Right 1181549728 22:23630803-23630825 TCCAGGTCCTCACTCCTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181549728 Original CRISPR TCCAGGTCCTCACTCCTATC AGG Intronic