ID: 1181549729

View in Genome Browser
Species Human (GRCh38)
Location 22:23630804-23630826
Sequence TCCTGATAGGAGTGAGGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181549729_1181549736 13 Left 1181549729 22:23630804-23630826 CCAGGTCCTCACTCCTATCAGGA No data
Right 1181549736 22:23630840-23630862 CAGGCTCTCCAGACAGAAGCAGG No data
1181549729_1181549733 -6 Left 1181549729 22:23630804-23630826 CCAGGTCCTCACTCCTATCAGGA No data
Right 1181549733 22:23630821-23630843 TCAGGAACCTGAAGCCAGGCAGG No data
1181549729_1181549732 -10 Left 1181549729 22:23630804-23630826 CCAGGTCCTCACTCCTATCAGGA No data
Right 1181549732 22:23630817-23630839 CCTATCAGGAACCTGAAGCCAGG No data
1181549729_1181549737 14 Left 1181549729 22:23630804-23630826 CCAGGTCCTCACTCCTATCAGGA No data
Right 1181549737 22:23630841-23630863 AGGCTCTCCAGACAGAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181549729 Original CRISPR TCCTGATAGGAGTGAGGACC TGG (reversed) Intronic