ID: 1181549732

View in Genome Browser
Species Human (GRCh38)
Location 22:23630817-23630839
Sequence CCTATCAGGAACCTGAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181549729_1181549732 -10 Left 1181549729 22:23630804-23630826 CCAGGTCCTCACTCCTATCAGGA 0: 2
1: 2
2: 0
3: 11
4: 134
Right 1181549732 22:23630817-23630839 CCTATCAGGAACCTGAAGCCAGG No data
1181549726_1181549732 13 Left 1181549726 22:23630781-23630803 CCATCTGTTTCTCACACTGCACT 0: 1
1: 2
2: 4
3: 40
4: 436
Right 1181549732 22:23630817-23630839 CCTATCAGGAACCTGAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181549732 Original CRISPR CCTATCAGGAACCTGAAGCC AGG Intronic
No off target data available for this crispr