ID: 1181549732

View in Genome Browser
Species Human (GRCh38)
Location 22:23630817-23630839
Sequence CCTATCAGGAACCTGAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181549726_1181549732 13 Left 1181549726 22:23630781-23630803 CCATCTGTTTCTCACACTGCACT No data
Right 1181549732 22:23630817-23630839 CCTATCAGGAACCTGAAGCCAGG No data
1181549729_1181549732 -10 Left 1181549729 22:23630804-23630826 CCAGGTCCTCACTCCTATCAGGA No data
Right 1181549732 22:23630817-23630839 CCTATCAGGAACCTGAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181549732 Original CRISPR CCTATCAGGAACCTGAAGCC AGG Intronic