ID: 1181550930

View in Genome Browser
Species Human (GRCh38)
Location 22:23638815-23638837
Sequence AATCTTGATGGTGACCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 2, 2: 0, 3: 16, 4: 141}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181550930_1181550936 13 Left 1181550930 22:23638815-23638837 CCTTCCAGGTCACCATCAAGATT 0: 1
1: 2
2: 0
3: 16
4: 141
Right 1181550936 22:23638851-23638873 ATTCATGAGACACACCAGTGTGG No data
1181550930_1181550941 29 Left 1181550930 22:23638815-23638837 CCTTCCAGGTCACCATCAAGATT 0: 1
1: 2
2: 0
3: 16
4: 141
Right 1181550941 22:23638867-23638889 AGTGTGGCCTTGTTGGCTTGGGG 0: 1
1: 0
2: 1
3: 10
4: 195
1181550930_1181550937 22 Left 1181550930 22:23638815-23638837 CCTTCCAGGTCACCATCAAGATT 0: 1
1: 2
2: 0
3: 16
4: 141
Right 1181550937 22:23638860-23638882 ACACACCAGTGTGGCCTTGTTGG No data
1181550930_1181550939 27 Left 1181550930 22:23638815-23638837 CCTTCCAGGTCACCATCAAGATT 0: 1
1: 2
2: 0
3: 16
4: 141
Right 1181550939 22:23638865-23638887 CCAGTGTGGCCTTGTTGGCTTGG No data
1181550930_1181550940 28 Left 1181550930 22:23638815-23638837 CCTTCCAGGTCACCATCAAGATT 0: 1
1: 2
2: 0
3: 16
4: 141
Right 1181550940 22:23638866-23638888 CAGTGTGGCCTTGTTGGCTTGGG 0: 1
1: 0
2: 2
3: 12
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181550930 Original CRISPR AATCTTGATGGTGACCTGGA AGG (reversed) Intergenic