ID: 1181550933

View in Genome Browser
Species Human (GRCh38)
Location 22:23638827-23638849
Sequence ACTTTATCCGGGAATCTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 64}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181550933_1181550939 15 Left 1181550933 22:23638827-23638849 CCATCAAGATTCCCGGATAAAGT 0: 1
1: 0
2: 1
3: 3
4: 64
Right 1181550939 22:23638865-23638887 CCAGTGTGGCCTTGTTGGCTTGG No data
1181550933_1181550936 1 Left 1181550933 22:23638827-23638849 CCATCAAGATTCCCGGATAAAGT 0: 1
1: 0
2: 1
3: 3
4: 64
Right 1181550936 22:23638851-23638873 ATTCATGAGACACACCAGTGTGG No data
1181550933_1181550943 28 Left 1181550933 22:23638827-23638849 CCATCAAGATTCCCGGATAAAGT 0: 1
1: 0
2: 1
3: 3
4: 64
Right 1181550943 22:23638878-23638900 GTTGGCTTGGGGCTCCTCACAGG 0: 1
1: 0
2: 4
3: 15
4: 130
1181550933_1181550937 10 Left 1181550933 22:23638827-23638849 CCATCAAGATTCCCGGATAAAGT 0: 1
1: 0
2: 1
3: 3
4: 64
Right 1181550937 22:23638860-23638882 ACACACCAGTGTGGCCTTGTTGG No data
1181550933_1181550941 17 Left 1181550933 22:23638827-23638849 CCATCAAGATTCCCGGATAAAGT 0: 1
1: 0
2: 1
3: 3
4: 64
Right 1181550941 22:23638867-23638889 AGTGTGGCCTTGTTGGCTTGGGG 0: 1
1: 0
2: 1
3: 10
4: 195
1181550933_1181550940 16 Left 1181550933 22:23638827-23638849 CCATCAAGATTCCCGGATAAAGT 0: 1
1: 0
2: 1
3: 3
4: 64
Right 1181550940 22:23638866-23638888 CAGTGTGGCCTTGTTGGCTTGGG 0: 1
1: 0
2: 2
3: 12
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181550933 Original CRISPR ACTTTATCCGGGAATCTTGA TGG (reversed) Intergenic
903248899 1:22037885-22037907 ACTCTGTCCGTGAATCTTGGGGG + Intergenic
921546993 1:216484735-216484757 ACTTTCTCCAGGAATCTTCATGG + Intergenic
923358983 1:233188895-233188917 ACATTATCTGGCAAACTTGAAGG - Intronic
923570658 1:235110536-235110558 ACTTTTCTCGGGTATCTTGAGGG - Exonic
924647406 1:245891467-245891489 ACTTTGTCCAGGAATCTGGGGGG + Intronic
1068822849 10:61397920-61397942 ACTGTATCATGGAAACTTGAAGG + Intergenic
1071204673 10:83260237-83260259 ATTTTCTCCTGGAATTTTGACGG + Intergenic
1079368767 11:19832261-19832283 AGTTTTTCCCTGAATCTTGACGG + Intronic
1081479480 11:43471660-43471682 ACTTTATCCGTGAATACTCATGG - Intronic
1106940742 13:34776500-34776522 ACTTTATGAGGGAAACTTAAAGG - Intergenic
1113445233 13:110361006-110361028 ACTTTATCAGTGAATGTTCAGGG - Intronic
1132314006 15:100878082-100878104 ACTTTATCGGGGGTCCTTGATGG - Intronic
1146031528 17:29370460-29370482 ACTTTATTCTGGAAACTTTAGGG - Intergenic
1147933751 17:43999348-43999370 GCTTTTTCCAGGAATTTTGAAGG + Intronic
1152533438 17:80935990-80936012 CCTTTATCATGGAATTTTGAGGG - Intronic
1157976274 18:52330733-52330755 ACTTTATCCTGGGCTCTAGATGG - Intergenic
1159195741 18:65111503-65111525 ACTCTATCTGTCAATCTTGAGGG + Intergenic
1168646569 19:58062906-58062928 ACTTTAGCCTAGAAGCTTGAGGG - Intronic
929364712 2:41139824-41139846 ACTTTATGCTGTGATCTTGAGGG - Intergenic
931383894 2:61779075-61779097 ATTTTTTCCAGGAATCTAGAGGG + Intergenic
932686225 2:73872624-73872646 ACTTTATCCCGAAGTGTTGAGGG + Intronic
940060073 2:149555681-149555703 ACTTTATTCAGGAATCATGCTGG + Intergenic
943246253 2:185455342-185455364 ACTTTATCCTTGAATTTTGGGGG - Intergenic
945032826 2:205681706-205681728 ACTTTTTCGGGGGAACTTGATGG + Intergenic
946444578 2:219727293-219727315 GCTTTAACAGAGAATCTTGAGGG + Intergenic
946498464 2:220219850-220219872 ATTTTATCTGGGGATCTTAAAGG - Intergenic
947553780 2:231069112-231069134 ACTTCATTGGGGAATCTAGAAGG + Intronic
1173258823 20:41415182-41415204 ACTTCAGGCGGGAATCTTGGTGG - Exonic
1180570013 22:16705886-16705908 ACTTTATAAGGGAATATTTAAGG + Intergenic
1181541031 22:23573469-23573491 CTTTTATCCGGGAATCTTGACGG - Exonic
1181550933 22:23638827-23638849 ACTTTATCCGGGAATCTTGATGG - Intergenic
1181797350 22:25319861-25319883 CTTCTATCTGGGAATCTTGACGG + Intergenic
1183543683 22:38444287-38444309 ACCCTTTCCGGGAATTTTGACGG - Intronic
949695822 3:6694343-6694365 ACTTAATCAGCCAATCTTGAGGG + Intergenic
952647172 3:35674554-35674576 ACTTTATCTGGGAATAATGCAGG + Intronic
956558404 3:70546448-70546470 ACTTTATTAGTGAATCTGGAGGG - Intergenic
960672288 3:120165434-120165456 AATTTATCATGGAATCTTGGGGG - Intronic
963723845 3:148896617-148896639 GCTTTATCCGGGATTCTGGAAGG - Exonic
964667187 3:159187659-159187681 ACGTTATCAGGGAAGCTCGAAGG + Intronic
966867762 3:184269694-184269716 ACTTTAGCCTGGAAAATTGAGGG - Intronic
973108691 4:46373351-46373373 AGATTATCAGGGAAGCTTGAAGG + Intronic
987964446 5:24853622-24853644 ACTTTATCAGGTATTATTGATGG + Intergenic
990635327 5:57719388-57719410 ACTTAATCCTGTAAACTTGATGG - Intergenic
992353333 5:75953587-75953609 ACTTTATCCGGAAACCCAGAAGG + Intergenic
992622289 5:78605905-78605927 ACTTTATATGGGGATCGTGAGGG - Intronic
997955462 5:138275345-138275367 GCTTTATCCTGGGATCTTGTGGG - Intergenic
1000780513 5:165474437-165474459 AATTTATCAGGGAATGTTTATGG + Intergenic
1003962239 6:11219511-11219533 ACTTTAGCCTGGACTCTTGTGGG + Intronic
1006153190 6:32000317-32000339 TCCCTATCCGGGAATCTTGTTGG - Intronic
1006159498 6:32033054-32033076 TCCCTATCCGGGAATCTTGTTGG - Intronic
1009043912 6:58214883-58214905 ACTATATGCCAGAATCTTGAAGG + Intergenic
1009219749 6:60969142-60969164 ACTATATGCCAGAATCTTGAAGG + Intergenic
1011748268 6:90429169-90429191 AGTTTATCAGGGAATCTTCCTGG - Intergenic
1012147730 6:95707469-95707491 CCTTTTTCCAGGAATCTTCATGG + Intergenic
1026661355 7:72305454-72305476 ACTTTACGTGGGGATCTTGAAGG - Intronic
1026959350 7:74398660-74398682 TCTTTATCCCGGAACCCTGAGGG - Intronic
1037426466 8:18760959-18760981 AGATTATCCTGGAATATTGATGG - Intronic
1041836055 8:62216626-62216648 TCTTTATCTGGGATTCTTGGAGG + Intergenic
1042787904 8:72569844-72569866 ACTTTCTCTGGAAATTTTGATGG - Intronic
1043301953 8:78744685-78744707 ACTTTTGCCGGGAAGCCTGAAGG + Intronic
1044110447 8:88266532-88266554 ACCTCATCCAGGAATCTTTATGG + Intronic
1046031439 8:108787521-108787543 ACTTTCTCCGGGAACCGTGCCGG - Exonic
1052552866 9:29973342-29973364 CCTTTATCCAGGACTCATGAGGG - Intergenic
1056626011 9:88253916-88253938 CCTTTTTCCAGGAATCTTCATGG + Intergenic
1056697271 9:88870639-88870661 ACTTTTTCCTGGATTCTTGAGGG - Intergenic
1187583689 X:20636664-20636686 AATTTATCAGGAAATCTTGTTGG + Intergenic
1187745287 X:22402837-22402859 ACTTTATCTGAGCATCTTAAAGG + Intergenic
1194762715 X:97813657-97813679 AGTTTTTCAGGGAATTTTGATGG - Intergenic
1197133117 X:123028714-123028736 ACTTTACTTGGGAATCCTGAAGG + Intergenic