ID: 1181550933

View in Genome Browser
Species Human (GRCh38)
Location 22:23638827-23638849
Sequence ACTTTATCCGGGAATCTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 64}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181550933_1181550943 28 Left 1181550933 22:23638827-23638849 CCATCAAGATTCCCGGATAAAGT 0: 1
1: 0
2: 1
3: 3
4: 64
Right 1181550943 22:23638878-23638900 GTTGGCTTGGGGCTCCTCACAGG 0: 1
1: 0
2: 4
3: 15
4: 130
1181550933_1181550940 16 Left 1181550933 22:23638827-23638849 CCATCAAGATTCCCGGATAAAGT 0: 1
1: 0
2: 1
3: 3
4: 64
Right 1181550940 22:23638866-23638888 CAGTGTGGCCTTGTTGGCTTGGG 0: 1
1: 0
2: 2
3: 12
4: 173
1181550933_1181550939 15 Left 1181550933 22:23638827-23638849 CCATCAAGATTCCCGGATAAAGT 0: 1
1: 0
2: 1
3: 3
4: 64
Right 1181550939 22:23638865-23638887 CCAGTGTGGCCTTGTTGGCTTGG No data
1181550933_1181550936 1 Left 1181550933 22:23638827-23638849 CCATCAAGATTCCCGGATAAAGT 0: 1
1: 0
2: 1
3: 3
4: 64
Right 1181550936 22:23638851-23638873 ATTCATGAGACACACCAGTGTGG No data
1181550933_1181550941 17 Left 1181550933 22:23638827-23638849 CCATCAAGATTCCCGGATAAAGT 0: 1
1: 0
2: 1
3: 3
4: 64
Right 1181550941 22:23638867-23638889 AGTGTGGCCTTGTTGGCTTGGGG 0: 1
1: 0
2: 1
3: 10
4: 195
1181550933_1181550937 10 Left 1181550933 22:23638827-23638849 CCATCAAGATTCCCGGATAAAGT 0: 1
1: 0
2: 1
3: 3
4: 64
Right 1181550937 22:23638860-23638882 ACACACCAGTGTGGCCTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181550933 Original CRISPR ACTTTATCCGGGAATCTTGA TGG (reversed) Intergenic