ID: 1181550934

View in Genome Browser
Species Human (GRCh38)
Location 22:23638838-23638860
Sequence TCTCATGAATAACTTTATCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 149}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181550934_1181550941 6 Left 1181550934 22:23638838-23638860 CCCGGATAAAGTTATTCATGAGA 0: 1
1: 0
2: 3
3: 7
4: 149
Right 1181550941 22:23638867-23638889 AGTGTGGCCTTGTTGGCTTGGGG 0: 1
1: 0
2: 1
3: 10
4: 195
1181550934_1181550937 -1 Left 1181550934 22:23638838-23638860 CCCGGATAAAGTTATTCATGAGA 0: 1
1: 0
2: 3
3: 7
4: 149
Right 1181550937 22:23638860-23638882 ACACACCAGTGTGGCCTTGTTGG No data
1181550934_1181550936 -10 Left 1181550934 22:23638838-23638860 CCCGGATAAAGTTATTCATGAGA 0: 1
1: 0
2: 3
3: 7
4: 149
Right 1181550936 22:23638851-23638873 ATTCATGAGACACACCAGTGTGG No data
1181550934_1181550940 5 Left 1181550934 22:23638838-23638860 CCCGGATAAAGTTATTCATGAGA 0: 1
1: 0
2: 3
3: 7
4: 149
Right 1181550940 22:23638866-23638888 CAGTGTGGCCTTGTTGGCTTGGG 0: 1
1: 0
2: 2
3: 12
4: 173
1181550934_1181550944 21 Left 1181550934 22:23638838-23638860 CCCGGATAAAGTTATTCATGAGA 0: 1
1: 0
2: 3
3: 7
4: 149
Right 1181550944 22:23638882-23638904 GCTTGGGGCTCCTCACAGGACGG 0: 1
1: 0
2: 8
3: 135
4: 486
1181550934_1181550945 25 Left 1181550934 22:23638838-23638860 CCCGGATAAAGTTATTCATGAGA 0: 1
1: 0
2: 3
3: 7
4: 149
Right 1181550945 22:23638886-23638908 GGGGCTCCTCACAGGACGGCAGG 0: 1
1: 0
2: 3
3: 12
4: 170
1181550934_1181550939 4 Left 1181550934 22:23638838-23638860 CCCGGATAAAGTTATTCATGAGA 0: 1
1: 0
2: 3
3: 7
4: 149
Right 1181550939 22:23638865-23638887 CCAGTGTGGCCTTGTTGGCTTGG No data
1181550934_1181550943 17 Left 1181550934 22:23638838-23638860 CCCGGATAAAGTTATTCATGAGA 0: 1
1: 0
2: 3
3: 7
4: 149
Right 1181550943 22:23638878-23638900 GTTGGCTTGGGGCTCCTCACAGG 0: 1
1: 0
2: 4
3: 15
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181550934 Original CRISPR TCTCATGAATAACTTTATCC GGG (reversed) Intergenic